Incidental Mutation 'R3793:Itga4'
ID272627
Institutional Source Beutler Lab
Gene Symbol Itga4
Ensembl Gene ENSMUSG00000027009
Gene Nameintegrin alpha 4
SynonymsVLA-4 receptor, alpha 4 subunit
MMRRC Submission 040755-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3793 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location79255426-79333123 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 79279128 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 224 (T224A)
Ref Sequence ENSEMBL: ENSMUSP00000099718 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099972]
Predicted Effect probably benign
Transcript: ENSMUST00000099972
AA Change: T224A

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000099718
Gene: ENSMUSG00000027009
AA Change: T224A

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Int_alpha 48 108 5.14e-7 SMART
Int_alpha 191 241 3.45e1 SMART
Int_alpha 247 300 1.89e-5 SMART
Int_alpha 302 358 2.25e-12 SMART
Int_alpha 364 419 1.45e-15 SMART
Int_alpha 426 483 4.52e-3 SMART
SCOP:d1m1xa2 627 770 1e-35 SMART
Blast:Int_alpha 639 676 9e-16 BLAST
SCOP:d1m1xa3 773 948 7e-42 SMART
transmembrane domain 978 1000 N/A INTRINSIC
PDB:4HKC|B 1003 1032 1e-13 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126312
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135919
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.4%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gene encodes a member of the integrin alpha chain family of proteins. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain that function in cell surface adhesion and signaling. The encoded preproprotein is proteolytically processed to generate light and heavy chains that comprise the alpha 4 subunit. This subunit associates with a beta 1 or beta 7 subunit to form an integrin that may play a role in cell motility and migration. This integrin is a therapeutic target for the treatment of multiple sclerosis, Crohn's disease and inflammatory bowel disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for disruptions in this gene exhibit embryonic lethality either due to failure of chorioallantoic fusion or cardiac abnormalities, including hemorrhage around the heart and defects in epicardium formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap13 A G 7: 75,610,141 T35A probably benign Het
Arhgap32 T A 9: 32,255,373 S435R probably damaging Het
Asic1 A T 15: 99,672,025 K76* probably null Het
B9d1 A G 11: 61,507,622 probably benign Het
Casd1 T C 6: 4,619,876 V207A possibly damaging Het
Cass4 C T 2: 172,432,558 P753L probably damaging Het
Ccdc129 A T 6: 55,975,603 M844L possibly damaging Het
Cnfn T C 7: 25,368,380 N45S probably benign Het
Col14a1 G T 15: 55,363,513 D220Y unknown Het
Csn1s1 T A 5: 87,680,843 Y274* probably null Het
Cyp2c69 T C 19: 39,881,156 T140A probably benign Het
Dlg2 A T 7: 91,810,535 probably benign Het
Esp16 T C 17: 39,537,848 I11T possibly damaging Het
Esyt3 A T 9: 99,315,281 F832Y possibly damaging Het
Ift172 C T 5: 31,257,581 D1366N possibly damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Krt71 C T 15: 101,742,910 S46N probably damaging Het
Lhx1 A G 11: 84,521,900 S65P probably benign Het
Lingo4 A G 3: 94,402,378 S208G probably benign Het
Lrrc2 T A 9: 110,966,517 C123* probably null Het
Nfrkb A T 9: 31,409,932 probably benign Het
Nfx1 T A 4: 41,004,357 C709* probably null Het
Nlrp14 A T 7: 107,182,274 Q226L probably benign Het
Ocln T C 13: 100,498,894 R496G possibly damaging Het
Olfr1360 T C 13: 21,674,983 probably null Het
Olfr866 T A 9: 20,027,063 I292F probably damaging Het
Osgepl1 T C 1: 53,320,247 I305T probably damaging Het
Ovgp1 A G 3: 105,980,171 N266S probably benign Het
Per1 A G 11: 69,109,301 E1273G probably benign Het
Plch1 A G 3: 63,697,831 Y1542H probably damaging Het
Pold1 A G 7: 44,541,570 F252L probably damaging Het
Ptk2b A T 14: 66,170,251 D607E probably damaging Het
Sdf4 T A 4: 156,002,459 probably null Het
Sirt4 T C 5: 115,480,292 D241G probably benign Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Slco1b2 A G 6: 141,676,307 Y531C probably damaging Het
Tmem200a A T 10: 25,994,189 S61T probably damaging Het
Trp53bp1 T C 2: 121,200,329 I1784V probably damaging Het
Uba2 A C 7: 34,146,297 V467G probably damaging Het
Ubr3 T C 2: 69,917,181 S263P possibly damaging Het
Ugt2b35 A G 5: 87,001,606 T239A probably benign Het
Wac T C 18: 7,920,190 V348A possibly damaging Het
Wdr3 A T 3: 100,151,965 M346K probably benign Het
Zfp607a A T 7: 27,878,906 H467L probably benign Het
Other mutations in Itga4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Itga4 APN 2 79292050 missense probably benign 0.01
IGL01317:Itga4 APN 2 79322661 nonsense probably null
IGL01545:Itga4 APN 2 79315970 splice site probably benign
IGL01570:Itga4 APN 2 79322634 critical splice acceptor site probably null
IGL01575:Itga4 APN 2 79288255 missense probably damaging 1.00
IGL01837:Itga4 APN 2 79315005 missense probably damaging 1.00
IGL01974:Itga4 APN 2 79273127 splice site probably benign
IGL02087:Itga4 APN 2 79292069 missense probably damaging 0.99
IGL02245:Itga4 APN 2 79320559 missense probably benign 0.01
IGL02492:Itga4 APN 2 79255657 utr 5 prime probably benign
IGL02809:Itga4 APN 2 79280577 missense probably damaging 1.00
IGL02998:Itga4 APN 2 79277821 missense possibly damaging 0.88
IGL03008:Itga4 APN 2 79325638 missense probably benign
IGL03282:Itga4 APN 2 79325594 missense probably damaging 0.98
IGL03285:Itga4 APN 2 79279166 missense possibly damaging 0.48
IGL03286:Itga4 APN 2 79289362 missense probably damaging 1.00
R0001:Itga4 UTSW 2 79326587 missense probably damaging 0.99
R0045:Itga4 UTSW 2 79301031 missense probably damaging 1.00
R0276:Itga4 UTSW 2 79321493 missense probably damaging 0.99
R0554:Itga4 UTSW 2 79279117 missense probably damaging 1.00
R0556:Itga4 UTSW 2 79325639 missense probably benign
R0785:Itga4 UTSW 2 79289305 missense possibly damaging 0.89
R0787:Itga4 UTSW 2 79279153 missense probably benign 0.01
R1013:Itga4 UTSW 2 79320503 missense probably benign 0.00
R1237:Itga4 UTSW 2 79279146 missense probably null 0.08
R1295:Itga4 UTSW 2 79322689 missense possibly damaging 0.82
R1471:Itga4 UTSW 2 79287032 missense probably benign 0.26
R1559:Itga4 UTSW 2 79315688 missense probably benign 0.04
R1769:Itga4 UTSW 2 79315706 critical splice donor site probably null
R1931:Itga4 UTSW 2 79313844 critical splice donor site probably null
R2012:Itga4 UTSW 2 79277794 missense probably damaging 1.00
R2241:Itga4 UTSW 2 79301013 missense probably damaging 1.00
R4133:Itga4 UTSW 2 79322652 missense probably damaging 1.00
R4204:Itga4 UTSW 2 79279161 missense probably damaging 0.97
R4296:Itga4 UTSW 2 79272799 missense probably damaging 1.00
R4777:Itga4 UTSW 2 79313710 missense possibly damaging 0.87
R4906:Itga4 UTSW 2 79288248 missense probably damaging 1.00
R5048:Itga4 UTSW 2 79273034 missense probably benign 0.04
R5087:Itga4 UTSW 2 79315629 missense possibly damaging 0.95
R5212:Itga4 UTSW 2 79280595 missense probably damaging 1.00
R5213:Itga4 UTSW 2 79320576 missense probably benign 0.29
R5421:Itga4 UTSW 2 79316041 nonsense probably null
R5549:Itga4 UTSW 2 79256267 missense probably damaging 0.98
R5907:Itga4 UTSW 2 79322656 missense probably benign
R5917:Itga4 UTSW 2 79287098 missense probably damaging 1.00
R6309:Itga4 UTSW 2 79279085 missense probably damaging 1.00
R6764:Itga4 UTSW 2 79325614 missense probably benign 0.02
R6787:Itga4 UTSW 2 79289265 missense probably damaging 0.97
R6790:Itga4 UTSW 2 79325614 missense probably benign 0.02
R7051:Itga4 UTSW 2 79318126 missense possibly damaging 0.91
R7311:Itga4 UTSW 2 79256182 missense probably benign
R7520:Itga4 UTSW 2 79300989 missense probably damaging 1.00
R7573:Itga4 UTSW 2 79272993 missense probably benign
R7636:Itga4 UTSW 2 79313832 missense probably benign 0.01
R7889:Itga4 UTSW 2 79316045 missense probably benign 0.05
R7972:Itga4 UTSW 2 79316045 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GCCTTTGATATTTGAAACCCACTG -3'
(R):5'- AAATGCAGCTGGCTTTATGC -3'

Sequencing Primer
(F):5'- GGGCAAAAAGTTCCAGAGTTTCTTC -3'
(R):5'- CAGCTGGCTTTATGCTTAATTGAGAC -3'
Posted On2015-03-25