Incidental Mutation 'R3793:Casd1'
ID272645
Institutional Source Beutler Lab
Gene Symbol Casd1
Ensembl Gene ENSMUSG00000015189
Gene NameCAS1 domain containing 1
SynonymsCast1
MMRRC Submission 040755-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.241) question?
Stock #R3793 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location4600839-4643355 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 4619876 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 207 (V207A)
Ref Sequence ENSEMBL: ENSMUSP00000137822 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015333] [ENSMUST00000181734]
Predicted Effect probably benign
Transcript: ENSMUST00000015333
AA Change: V207A

PolyPhen 2 Score 0.412 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000015333
Gene: ENSMUSG00000015189
AA Change: V207A

DomainStartEndE-ValueType
low complexity region 22 39 N/A INTRINSIC
Pfam:PC-Esterase 71 292 6.3e-33 PFAM
Pfam:Cas1_AcylT 295 776 9.4e-220 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000141359
AA Change: V159A
SMART Domains Protein: ENSMUSP00000115427
Gene: ENSMUSG00000015189
AA Change: V159A

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:PC-Esterase 60 113 1.5e-13 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000181734
AA Change: V207A

PolyPhen 2 Score 0.901 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000137822
Gene: ENSMUSG00000015189
AA Change: V207A

DomainStartEndE-ValueType
low complexity region 22 39 N/A INTRINSIC
Pfam:PC-Esterase 74 271 2.9e-18 PFAM
Pfam:Cas1_AcylT 272 402 3.4e-45 PFAM
Pfam:Cas1_AcylT 399 484 3.4e-37 PFAM
Pfam:Cas1_AcylT 480 527 4.4e-11 PFAM
Meta Mutation Damage Score 0.1140 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.4%
Validation Efficiency 98% (50/51)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap13 A G 7: 75,610,141 T35A probably benign Het
Arhgap32 T A 9: 32,255,373 S435R probably damaging Het
Asic1 A T 15: 99,672,025 K76* probably null Het
B9d1 A G 11: 61,507,622 probably benign Het
Cass4 C T 2: 172,432,558 P753L probably damaging Het
Ccdc129 A T 6: 55,975,603 M844L possibly damaging Het
Cnfn T C 7: 25,368,380 N45S probably benign Het
Col14a1 G T 15: 55,363,513 D220Y unknown Het
Csn1s1 T A 5: 87,680,843 Y274* probably null Het
Cyp2c69 T C 19: 39,881,156 T140A probably benign Het
Dlg2 A T 7: 91,810,535 probably benign Het
Esp16 T C 17: 39,537,848 I11T possibly damaging Het
Esyt3 A T 9: 99,315,281 F832Y possibly damaging Het
Ift172 C T 5: 31,257,581 D1366N possibly damaging Het
Itga4 A G 2: 79,279,128 T224A probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Krt71 C T 15: 101,742,910 S46N probably damaging Het
Lhx1 A G 11: 84,521,900 S65P probably benign Het
Lingo4 A G 3: 94,402,378 S208G probably benign Het
Lrrc2 T A 9: 110,966,517 C123* probably null Het
Nfrkb A T 9: 31,409,932 probably benign Het
Nfx1 T A 4: 41,004,357 C709* probably null Het
Nlrp14 A T 7: 107,182,274 Q226L probably benign Het
Ocln T C 13: 100,498,894 R496G possibly damaging Het
Olfr1360 T C 13: 21,674,983 probably null Het
Olfr866 T A 9: 20,027,063 I292F probably damaging Het
Osgepl1 T C 1: 53,320,247 I305T probably damaging Het
Ovgp1 A G 3: 105,980,171 N266S probably benign Het
Per1 A G 11: 69,109,301 E1273G probably benign Het
Plch1 A G 3: 63,697,831 Y1542H probably damaging Het
Pold1 A G 7: 44,541,570 F252L probably damaging Het
Ptk2b A T 14: 66,170,251 D607E probably damaging Het
Sdf4 T A 4: 156,002,459 probably null Het
Sirt4 T C 5: 115,480,292 D241G probably benign Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Slco1b2 A G 6: 141,676,307 Y531C probably damaging Het
Tmem200a A T 10: 25,994,189 S61T probably damaging Het
Trp53bp1 T C 2: 121,200,329 I1784V probably damaging Het
Uba2 A C 7: 34,146,297 V467G probably damaging Het
Ubr3 T C 2: 69,917,181 S263P possibly damaging Het
Ugt2b35 A G 5: 87,001,606 T239A probably benign Het
Wac T C 18: 7,920,190 V348A possibly damaging Het
Wdr3 A T 3: 100,151,965 M346K probably benign Het
Zfp607a A T 7: 27,878,906 H467L probably benign Het
Other mutations in Casd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00704:Casd1 APN 6 4607979 splice site probably benign
IGL00788:Casd1 APN 6 4624400 missense probably benign 0.30
IGL01161:Casd1 APN 6 4619833 missense possibly damaging 0.68
IGL01558:Casd1 APN 6 4624143 missense possibly damaging 0.56
IGL02124:Casd1 APN 6 4624142 missense probably benign 0.26
IGL02550:Casd1 APN 6 4642009 missense probably benign 0.03
IGL02822:Casd1 APN 6 4630017 missense probably damaging 1.00
IGL02957:Casd1 APN 6 4634068 missense possibly damaging 0.84
IGL03113:Casd1 APN 6 4640951 missense probably damaging 0.99
IGL03138:Casd1 UTSW 6 4613236 missense probably damaging 1.00
R0653:Casd1 UTSW 6 4608075 missense probably benign 0.00
R0673:Casd1 UTSW 6 4624440 missense possibly damaging 0.68
R0729:Casd1 UTSW 6 4619753 splice site probably benign
R0742:Casd1 UTSW 6 4635888 critical splice donor site probably null
R0941:Casd1 UTSW 6 4635848 missense probably damaging 1.00
R1056:Casd1 UTSW 6 4641967 missense probably benign 0.03
R1390:Casd1 UTSW 6 4641859 missense probably benign 0.04
R1394:Casd1 UTSW 6 4624117 missense probably damaging 1.00
R1643:Casd1 UTSW 6 4621243 missense probably benign 0.06
R1653:Casd1 UTSW 6 4624134 missense probably benign 0.00
R1713:Casd1 UTSW 6 4624104 missense probably damaging 1.00
R1861:Casd1 UTSW 6 4640951 missense probably damaging 0.99
R1906:Casd1 UTSW 6 4641979 missense probably damaging 1.00
R2094:Casd1 UTSW 6 4608705 missense probably damaging 1.00
R3896:Casd1 UTSW 6 4640980 missense probably damaging 1.00
R4519:Casd1 UTSW 6 4621102 missense probably benign 0.00
R4610:Casd1 UTSW 6 4631165 critical splice donor site probably null
R4673:Casd1 UTSW 6 4629975 missense probably damaging 0.97
R4819:Casd1 UTSW 6 4621225 missense probably damaging 0.99
R5920:Casd1 UTSW 6 4641853 missense probably null 1.00
R5929:Casd1 UTSW 6 4629993 missense probably damaging 1.00
R6130:Casd1 UTSW 6 4641948 missense probably damaging 1.00
R6181:Casd1 UTSW 6 4619331 missense probably damaging 1.00
R6291:Casd1 UTSW 6 4619834 missense probably damaging 0.96
R6305:Casd1 UTSW 6 4641892 missense probably damaging 1.00
R7147:Casd1 UTSW 6 4624187 missense probably benign 0.07
R7150:Casd1 UTSW 6 4624211 missense probably benign 0.01
R7657:Casd1 UTSW 6 4619773 missense probably benign 0.00
R8033:Casd1 UTSW 6 4619773 missense probably benign 0.00
X0021:Casd1 UTSW 6 4641935 missense probably damaging 1.00
Z1177:Casd1 UTSW 6 4631531 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- ACGTCTCTCTTCTGTGCTAAGG -3'
(R):5'- CGTAGTTTACAGCCATTCTGC -3'

Sequencing Primer
(F):5'- GGGCTGAAGTAATGCTTAACCTTCC -3'
(R):5'- AGCCATTCTGCTGCTGG -3'
Posted On2015-03-25