Incidental Mutation 'R3793:Olfr866'
ID272655
Institutional Source Beutler Lab
Gene Symbol Olfr866
Ensembl Gene ENSMUSG00000050803
Gene Nameolfactory receptor 866
SynonymsMOR145-5, GA_x6K02T2PVTD-13768406-13767468
MMRRC Submission 040755-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R3793 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location20026959-20028035 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 20027063 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 292 (I292F)
Ref Sequence ENSEMBL: ENSMUSP00000054864 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062248]
Predicted Effect probably damaging
Transcript: ENSMUST00000062248
AA Change: I292F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000054864
Gene: ENSMUSG00000050803
AA Change: I292F

DomainStartEndE-ValueType
Pfam:7tm_4 34 310 2e-47 PFAM
Pfam:7TM_GPCR_Srsx 38 282 8.7e-7 PFAM
Pfam:7tm_1 44 293 5.1e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197056
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212071
Meta Mutation Damage Score 0.2683 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.4%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap13 A G 7: 75,610,141 T35A probably benign Het
Arhgap32 T A 9: 32,255,373 S435R probably damaging Het
Asic1 A T 15: 99,672,025 K76* probably null Het
B9d1 A G 11: 61,507,622 probably benign Het
Casd1 T C 6: 4,619,876 V207A possibly damaging Het
Cass4 C T 2: 172,432,558 P753L probably damaging Het
Ccdc129 A T 6: 55,975,603 M844L possibly damaging Het
Cnfn T C 7: 25,368,380 N45S probably benign Het
Col14a1 G T 15: 55,363,513 D220Y unknown Het
Csn1s1 T A 5: 87,680,843 Y274* probably null Het
Cyp2c69 T C 19: 39,881,156 T140A probably benign Het
Dlg2 A T 7: 91,810,535 probably benign Het
Esp16 T C 17: 39,537,848 I11T possibly damaging Het
Esyt3 A T 9: 99,315,281 F832Y possibly damaging Het
Ift172 C T 5: 31,257,581 D1366N possibly damaging Het
Itga4 A G 2: 79,279,128 T224A probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Krt71 C T 15: 101,742,910 S46N probably damaging Het
Lhx1 A G 11: 84,521,900 S65P probably benign Het
Lingo4 A G 3: 94,402,378 S208G probably benign Het
Lrrc2 T A 9: 110,966,517 C123* probably null Het
Nfrkb A T 9: 31,409,932 probably benign Het
Nfx1 T A 4: 41,004,357 C709* probably null Het
Nlrp14 A T 7: 107,182,274 Q226L probably benign Het
Ocln T C 13: 100,498,894 R496G possibly damaging Het
Olfr1360 T C 13: 21,674,983 probably null Het
Osgepl1 T C 1: 53,320,247 I305T probably damaging Het
Ovgp1 A G 3: 105,980,171 N266S probably benign Het
Per1 A G 11: 69,109,301 E1273G probably benign Het
Plch1 A G 3: 63,697,831 Y1542H probably damaging Het
Pold1 A G 7: 44,541,570 F252L probably damaging Het
Ptk2b A T 14: 66,170,251 D607E probably damaging Het
Sdf4 T A 4: 156,002,459 probably null Het
Sirt4 T C 5: 115,480,292 D241G probably benign Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Slco1b2 A G 6: 141,676,307 Y531C probably damaging Het
Tmem200a A T 10: 25,994,189 S61T probably damaging Het
Trp53bp1 T C 2: 121,200,329 I1784V probably damaging Het
Uba2 A C 7: 34,146,297 V467G probably damaging Het
Ubr3 T C 2: 69,917,181 S263P possibly damaging Het
Ugt2b35 A G 5: 87,001,606 T239A probably benign Het
Wac T C 18: 7,920,190 V348A possibly damaging Het
Wdr3 A T 3: 100,151,965 M346K probably benign Het
Zfp607a A T 7: 27,878,906 H467L probably benign Het
Other mutations in Olfr866
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01353:Olfr866 APN 9 20027047 missense probably damaging 1.00
IGL01554:Olfr866 APN 9 20027408 missense possibly damaging 0.55
IGL01561:Olfr866 APN 9 20027522 missense probably benign 0.20
IGL01597:Olfr866 APN 9 20027686 missense probably damaging 0.98
IGL02986:Olfr866 APN 9 20027711 missense probably benign 0.43
IGL03101:Olfr866 APN 9 20027429 missense probably benign 0.03
R0863:Olfr866 UTSW 9 20027213 missense probably damaging 1.00
R1747:Olfr866 UTSW 9 20027317 missense probably benign 0.01
R2121:Olfr866 UTSW 9 20027501 missense probably benign
R2124:Olfr866 UTSW 9 20027501 missense probably benign
R2240:Olfr866 UTSW 9 20027144 missense probably damaging 1.00
R4498:Olfr866 UTSW 9 20027733 missense possibly damaging 0.50
R5084:Olfr866 UTSW 9 20027255 missense probably damaging 0.99
R5420:Olfr866 UTSW 9 20027059 missense probably damaging 0.98
R6314:Olfr866 UTSW 9 20027662 missense probably damaging 0.98
R6357:Olfr866 UTSW 9 20027629 missense probably damaging 1.00
R6588:Olfr866 UTSW 9 20027866 missense probably damaging 0.97
R6886:Olfr866 UTSW 9 20027132 missense probably benign 0.00
R7480:Olfr866 UTSW 9 20027934 start codon destroyed probably null
Z1088:Olfr866 UTSW 9 20027279 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATCCCAACCACAGTGATATGG -3'
(R):5'- AAAATCCCCTCCTCAAGTGG -3'

Sequencing Primer
(F):5'- CCACAGTGATATGGTTTTCAAAAAGC -3'
(R):5'- GGGAAATATAAAGCGTTCTCCACCTG -3'
Posted On2015-03-25