Incidental Mutation 'R3794:Olfr1217'
ID272678
Institutional Source Beutler Lab
Gene Symbol Olfr1217
Ensembl Gene ENSMUSG00000101391
Gene Nameolfactory receptor 1217
SynonymsMOR233-4, GA_x6K02T2Q125-50504545-50503631
MMRRC Submission 040756-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R3794 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location89021336-89032065 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 89023426 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 192 (H192Q)
Ref Sequence ENSEMBL: ENSMUSP00000149931 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099799] [ENSMUST00000213669] [ENSMUST00000214022] [ENSMUST00000216592]
Predicted Effect probably benign
Transcript: ENSMUST00000099799
AA Change: H192Q

PolyPhen 2 Score 0.411 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000097387
Gene: ENSMUSG00000101391
AA Change: H192Q

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 5.7e-48 PFAM
Pfam:7tm_1 39 286 6.3e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213669
AA Change: H192Q

PolyPhen 2 Score 0.411 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000214022
AA Change: H192Q

PolyPhen 2 Score 0.411 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000216592
AA Change: H192Q

PolyPhen 2 Score 0.411 (Sensitivity: 0.89; Specificity: 0.90)
Meta Mutation Damage Score 0.3954 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933403O08Rik T G X: 112,240,678 M1R probably null Het
Adcy6 C T 15: 98,598,943 V482I probably damaging Het
Adgrv1 T A 13: 81,283,367 M1L probably damaging Het
Ceacam13 A G 7: 18,013,415 *264W probably null Het
D430042O09Rik A G 7: 125,820,089 N476S probably benign Het
Dennd5b A T 6: 149,101,217 D31E possibly damaging Het
Dip2c T C 13: 9,604,561 V706A probably damaging Het
Enpp3 T C 10: 24,831,732 probably null Het
Exoc4 T G 6: 33,475,997 V474G probably benign Het
F2rl1 A G 13: 95,513,211 Y388H unknown Het
Fasl T C 1: 161,781,737 R17G probably benign Het
Htr1a G A 13: 105,444,344 V31M possibly damaging Het
Inpp4b T C 8: 82,033,216 V445A probably damaging Het
Itih3 T C 14: 30,918,394 Y319C probably damaging Het
Kmt2d T C 15: 98,837,359 probably benign Het
Mobp A T 9: 120,167,967 K55* probably null Het
Ndufaf5 T A 2: 140,202,923 M279K possibly damaging Het
Nlrc3 T C 16: 3,947,875 I1057V probably benign Het
Olfr129 A G 17: 38,054,895 Y224H probably damaging Het
Piezo2 C T 18: 63,081,793 R1257Q probably damaging Het
Pigv A G 4: 133,665,191 S223P possibly damaging Het
Pkdcc A G 17: 83,223,953 T464A probably damaging Het
Polr2k A G 15: 36,175,047 I18V probably damaging Het
Pon3 A G 6: 5,221,578 Y351H probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Scaf8 A G 17: 3,190,249 E632G probably damaging Het
Smurf1 A G 5: 144,901,175 probably null Het
Tcrg-V5 A T 13: 19,192,524 H47L probably benign Het
Tln1 G T 4: 43,536,295 A1999D probably damaging Het
Ttn C T 2: 76,942,437 V2405I possibly damaging Het
Vps13d G A 4: 145,085,437 probably benign Het
Xrcc1 A G 7: 24,570,560 T469A probably benign Het
Zfp287 G T 11: 62,714,244 H612Q probably damaging Het
Zfp352 C T 4: 90,225,149 H509Y probably damaging Het
Other mutations in Olfr1217
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01071:Olfr1217 APN 2 89023175 missense probably benign 0.00
IGL02034:Olfr1217 APN 2 89023671 missense probably benign 0.07
IGL03328:Olfr1217 APN 2 89023855 nonsense probably null
R0153:Olfr1217 UTSW 2 89023196 missense probably benign 0.00
R0414:Olfr1217 UTSW 2 89023146 missense probably damaging 1.00
R0544:Olfr1217 UTSW 2 89023826 missense probably damaging 1.00
R1994:Olfr1217 UTSW 2 89023143 missense probably damaging 1.00
R2217:Olfr1217 UTSW 2 89023426 missense probably benign 0.41
R3738:Olfr1217 UTSW 2 89023610 missense probably damaging 1.00
R3808:Olfr1217 UTSW 2 89023426 missense probably benign 0.41
R3809:Olfr1217 UTSW 2 89023426 missense probably benign 0.41
R5252:Olfr1217 UTSW 2 89023254 missense probably damaging 0.98
R5448:Olfr1217 UTSW 2 89023501 missense probably benign
R7524:Olfr1217 UTSW 2 89023971 missense probably benign 0.01
R8031:Olfr1217 UTSW 2 89023628 missense probably damaging 1.00
Z1176:Olfr1217 UTSW 2 89023795 missense possibly damaging 0.60
Z1176:Olfr1217 UTSW 2 89023896 missense probably damaging 1.00
Z1177:Olfr1217 UTSW 2 89023440 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAATGCAGAAGTAGGTCTTGC -3'
(R):5'- CTACTCTTCCATCATGACCCAGAG -3'

Sequencing Primer
(F):5'- TGGGCTCTCAGAGAAAAC -3'
(R):5'- ATCATGACCCAGAGGCTCTGTG -3'
Posted On2015-03-25