Incidental Mutation 'R3794:Ndufaf5'
ID272679
Institutional Source Beutler Lab
Gene Symbol Ndufaf5
Ensembl Gene ENSMUSG00000027384
Gene NameNADH dehydrogenase (ubiquinone) complex I, assembly factor 5
Synonyms
MMRRC Submission 040756-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.479) question?
Stock #R3794 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location140170649-140203689 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 140202923 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 279 (M279K)
Ref Sequence ENSEMBL: ENSMUSP00000035325 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044825]
Predicted Effect possibly damaging
Transcript: ENSMUST00000044825
AA Change: M279K

PolyPhen 2 Score 0.894 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000035325
Gene: ENSMUSG00000027384
AA Change: M279K

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Methyltransf_29 45 196 7.1e-8 PFAM
Pfam:Methyltransf_23 53 239 6.4e-16 PFAM
Pfam:Ubie_methyltran 78 204 3e-10 PFAM
Pfam:Methyltransf_18 89 187 1.1e-8 PFAM
Pfam:Methyltransf_31 92 243 9.6e-13 PFAM
Pfam:Methyltransf_25 93 182 1.3e-9 PFAM
Pfam:Methyltransf_12 94 184 2.4e-14 PFAM
Pfam:Methyltransf_11 94 186 6.3e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125913
Meta Mutation Damage Score 0.5665 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The NADH-ubiquinone oxidoreductase complex (complex I) of the mitochondrial respiratory chain catalyzes the transfer of electrons from NADH to ubiquinone, and consists of at least 43 subunits. The complex is located in the inner mitochondrial membrane. This gene encodes a mitochondrial protein that is associated with the matrix face of the mitochondrial inner membrane and is required for complex I assembly. A mutation in this gene results in mitochondrial complex I deficiency. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933403O08Rik T G X: 112,240,678 M1R probably null Het
Adcy6 C T 15: 98,598,943 V482I probably damaging Het
Adgrv1 T A 13: 81,283,367 M1L probably damaging Het
Ceacam13 A G 7: 18,013,415 *264W probably null Het
D430042O09Rik A G 7: 125,820,089 N476S probably benign Het
Dennd5b A T 6: 149,101,217 D31E possibly damaging Het
Dip2c T C 13: 9,604,561 V706A probably damaging Het
Enpp3 T C 10: 24,831,732 probably null Het
Exoc4 T G 6: 33,475,997 V474G probably benign Het
F2rl1 A G 13: 95,513,211 Y388H unknown Het
Fasl T C 1: 161,781,737 R17G probably benign Het
Htr1a G A 13: 105,444,344 V31M possibly damaging Het
Inpp4b T C 8: 82,033,216 V445A probably damaging Het
Itih3 T C 14: 30,918,394 Y319C probably damaging Het
Kmt2d T C 15: 98,837,359 probably benign Het
Mobp A T 9: 120,167,967 K55* probably null Het
Nlrc3 T C 16: 3,947,875 I1057V probably benign Het
Olfr1217 G T 2: 89,023,426 H192Q probably benign Het
Olfr129 A G 17: 38,054,895 Y224H probably damaging Het
Piezo2 C T 18: 63,081,793 R1257Q probably damaging Het
Pigv A G 4: 133,665,191 S223P possibly damaging Het
Pkdcc A G 17: 83,223,953 T464A probably damaging Het
Polr2k A G 15: 36,175,047 I18V probably damaging Het
Pon3 A G 6: 5,221,578 Y351H probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Scaf8 A G 17: 3,190,249 E632G probably damaging Het
Smurf1 A G 5: 144,901,175 probably null Het
Tcrg-V5 A T 13: 19,192,524 H47L probably benign Het
Tln1 G T 4: 43,536,295 A1999D probably damaging Het
Ttn C T 2: 76,942,437 V2405I possibly damaging Het
Vps13d G A 4: 145,085,437 probably benign Het
Xrcc1 A G 7: 24,570,560 T469A probably benign Het
Zfp287 G T 11: 62,714,244 H612Q probably damaging Het
Zfp352 C T 4: 90,225,149 H509Y probably damaging Het
Other mutations in Ndufaf5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02192:Ndufaf5 APN 2 140188743 missense probably benign 0.01
R0373:Ndufaf5 UTSW 2 140170881 missense probably benign 0.03
R1654:Ndufaf5 UTSW 2 140177300 splice site probably null
R1710:Ndufaf5 UTSW 2 140193602 missense possibly damaging 0.92
R1868:Ndufaf5 UTSW 2 140181589 missense probably benign 0.00
R2226:Ndufaf5 UTSW 2 140188860 missense probably benign 0.02
R4440:Ndufaf5 UTSW 2 140170725 missense probably benign 0.00
R4621:Ndufaf5 UTSW 2 140183925 missense probably benign 0.02
R4669:Ndufaf5 UTSW 2 140187755 missense probably benign 0.11
R5683:Ndufaf5 UTSW 2 140202923 missense possibly damaging 0.89
R6904:Ndufaf5 UTSW 2 140188780 nonsense probably null
R6937:Ndufaf5 UTSW 2 140181602 missense probably damaging 1.00
R8302:Ndufaf5 UTSW 2 140188778 missense possibly damaging 0.93
R8539:Ndufaf5 UTSW 2 140183974 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- GGATTCAAACAGCTTTGCTCAG -3'
(R):5'- AGCGGCTTGGAAACAGACAC -3'

Sequencing Primer
(F):5'- CAGTAAGCAGCCTAGCTCTAGTTTG -3'
(R):5'- CTTGGAAACAGACACAGATAAGATC -3'
Posted On2015-03-25