Mutagenetix > Incidental Mutations

Incidental Mutation 'R3794:Smurf1'

272684

Institutional Source

Beutler Lab

Gene Symbol

Smurf1

Ensembl Gene

ENSMUSG00000038780

Gene Name

SMAD specific E3 ubiquitin protein ligase 1

Synonyms

4930431E10Rik

MMRRC Submission

040756-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3794 (G1)

Quality Score

196

Status

Validated

Chromosome

Chromosomal Location

144876495-144965847 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to G at 144901175 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000106305 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000085684] [ENSMUST00000100461] [ENSMUST00000110677]

Predicted Effect

probably null
Transcript: ENSMUST00000085684

SMART Domains

Protein: ENSMUSP00000082827
Gene: ENSMUSG00000038780

Domain	Start	End	E-Value	Type
C2	14	117	3.03e-15	SMART
low complexity region	185	193	N/A	INTRINSIC
WW	235	267	1.06e-7	SMART
WW	281	313	8.66e-13	SMART
HECTc	392	731	3.48e-160	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000100461

SMART Domains

Protein: ENSMUSP00000098029
Gene: ENSMUSG00000038780

Domain	Start	End	E-Value	Type
C2	14	117	3.03e-15	SMART
low complexity region	185	193	N/A	INTRINSIC
WW	235	267	1.06e-7	SMART
WW	281	313	8.66e-13	SMART
HECTc	392	728	2.72e-162	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000110677

SMART Domains

Protein: ENSMUSP00000106305
Gene: ENSMUSG00000038780

Domain	Start	End	E-Value	Type
C2	14	117	3.03e-15	SMART
low complexity region	185	193	N/A	INTRINSIC
WW	235	267	1.06e-7	SMART
WW	307	339	8.66e-13	SMART
HECTc	418	757	3.48e-160	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183852

Predicted Effect

probably benign
Transcript: ENSMUST00000198621

Meta Mutation Damage Score

0.9499

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.4%

Validation Efficiency

97% (37/38)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitin ligase that is specific for receptor-regulated SMAD proteins in the bone morphogenetic protein (BMP) pathway. This protein plays a key roll in the regulation of cell motility, cell signalling, and cell polarity. Alternative splicing results in multiple transcript variants encoding different isoforms.[provided by RefSeq, Dec 2010]
PHENOTYPE: Mice homozygous for one knock-out allele display increased osteoblast function, bone density, and thickness of the cortical bone in long bones. Mice homozygous for a different knock-out allele are viable and only display gastrulation defects in combination with a Smurf2 knock-out allele. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933403O08Rik	T	G	X: 112,240,678	M1R	probably null	Het
Adcy6	C	T	15: 98,598,943	V482I	probably damaging	Het
Adgrv1	T	A	13: 81,283,367	M1L	probably damaging	Het
Ceacam13	A	G	7: 18,013,415	*264W	probably null	Het
D430042O09Rik	A	G	7: 125,820,089	N476S	probably benign	Het
Dennd5b	A	T	6: 149,101,217	D31E	possibly damaging	Het
Dip2c	T	C	13: 9,604,561	V706A	probably damaging	Het
Enpp3	T	C	10: 24,831,732		probably null	Het
Exoc4	T	G	6: 33,475,997	V474G	probably benign	Het
F2rl1	A	G	13: 95,513,211	Y388H	unknown	Het
Fasl	T	C	1: 161,781,737	R17G	probably benign	Het
Htr1a	G	A	13: 105,444,344	V31M	possibly damaging	Het
Inpp4b	T	C	8: 82,033,216	V445A	probably damaging	Het
Itih3	T	C	14: 30,918,394	Y319C	probably damaging	Het
Kmt2d	T	C	15: 98,837,359		probably benign	Het
Mobp	A	T	9: 120,167,967	K55*	probably null	Het
Ndufaf5	T	A	2: 140,202,923	M279K	possibly damaging	Het
Nlrc3	T	C	16: 3,947,875	I1057V	probably benign	Het
Olfr1217	G	T	2: 89,023,426	H192Q	probably benign	Het
Olfr129	A	G	17: 38,054,895	Y224H	probably damaging	Het
Piezo2	C	T	18: 63,081,793	R1257Q	probably damaging	Het
Pigv	A	G	4: 133,665,191	S223P	possibly damaging	Het
Pkdcc	A	G	17: 83,223,953	T464A	probably damaging	Het
Polr2k	A	G	15: 36,175,047	I18V	probably damaging	Het
Pon3	A	G	6: 5,221,578	Y351H	probably benign	Het
Rsf1	ATGGCG	ATGGCGACGGTGGCG	7: 97,579,904		probably benign	Het
Scaf8	A	G	17: 3,190,249	E632G	probably damaging	Het
Tcrg-V5	A	T	13: 19,192,524	H47L	probably benign	Het
Tln1	G	T	4: 43,536,295	A1999D	probably damaging	Het
Ttn	C	T	2: 76,942,437	V2405I	possibly damaging	Het
Vps13d	G	A	4: 145,085,437		probably benign	Het
Xrcc1	A	G	7: 24,570,560	T469A	probably benign	Het
Zfp287	G	T	11: 62,714,244	H612Q	probably damaging	Het
Zfp352	C	T	4: 90,225,149	H509Y	probably damaging	Het

Other mutations in Smurf1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00776:Smurf1	APN	5	144881774	missense	probably benign	0.00
IGL01577:Smurf1	APN	5	144893188	missense	probably damaging	0.99
IGL02232:Smurf1	APN	5	144886438	missense	probably damaging	1.00
IGL02407:Smurf1	APN	5	144884724	missense	probably damaging	1.00
IGL02959:Smurf1	APN	5	144899389	missense	probably damaging	1.00
IGL02997:Smurf1	APN	5	144898005	nonsense	probably null
IGL03227:Smurf1	APN	5	144899182	missense	probably damaging	1.00
IGL03293:Smurf1	APN	5	144881799	missense	probably benign
R1563:Smurf1	UTSW	5	144882513	missense	probably damaging	1.00
R1652:Smurf1	UTSW	5	144880664	missense	probably damaging	1.00
R2698:Smurf1	UTSW	5	144883562	unclassified	probably benign
R4274:Smurf1	UTSW	5	144896775	intron	probably benign
R4282:Smurf1	UTSW	5	144882593	missense	probably damaging	1.00
R4287:Smurf1	UTSW	5	144891458	missense	probably benign	0.00
R4643:Smurf1	UTSW	5	144879369	missense	probably damaging	1.00
R4723:Smurf1	UTSW	5	144893184	missense	probably damaging	1.00
R5496:Smurf1	UTSW	5	144882593	nonsense	probably null
R5702:Smurf1	UTSW	5	144901211	missense	possibly damaging	0.96
R5846:Smurf1	UTSW	5	144879380	missense	probably damaging	1.00
R6107:Smurf1	UTSW	5	144894504	missense	possibly damaging	0.75
R6263:Smurf1	UTSW	5	144881731	missense	probably damaging	0.96
R6477:Smurf1	UTSW	5	144889792	missense	possibly damaging	0.49
R6548:Smurf1	UTSW	5	144899497	missense	probably damaging	1.00
R6584:Smurf1	UTSW	5	144882523	missense	probably damaging	0.97
R6981:Smurf1	UTSW	5	144886369	missense	possibly damaging	0.69
R7062:Smurf1	UTSW	5	144893546	splice site	probably null
R7900:Smurf1	UTSW	5	144899373	missense	probably damaging	1.00
R8271:Smurf1	UTSW	5	144894087	missense	possibly damaging	0.53
R8361:Smurf1	UTSW	5	144883696	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTGTGGTAAGGGCCAAATCATG -3'
(R):5'- CACTCTCTTCTGTAGGATGCCG -3'

Sequencing Primer
(F):5'- TGGTAAGGGCCAAATCATGAAAACC -3'
(R):5'- GCTGTGCCACCAGGTAGACTC -3'

Posted On

2015-03-25