Incidental Mutation 'R3794:Smurf1'
ID272684
Institutional Source Beutler Lab
Gene Symbol Smurf1
Ensembl Gene ENSMUSG00000038780
Gene NameSMAD specific E3 ubiquitin protein ligase 1
Synonyms4930431E10Rik
MMRRC Submission 040756-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3794 (G1)
Quality Score196
Status Validated
Chromosome5
Chromosomal Location144876495-144965847 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 144901175 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000106305 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085684] [ENSMUST00000100461] [ENSMUST00000110677]
Predicted Effect probably null
Transcript: ENSMUST00000085684
SMART Domains Protein: ENSMUSP00000082827
Gene: ENSMUSG00000038780

DomainStartEndE-ValueType
C2 14 117 3.03e-15 SMART
low complexity region 185 193 N/A INTRINSIC
WW 235 267 1.06e-7 SMART
WW 281 313 8.66e-13 SMART
HECTc 392 731 3.48e-160 SMART
Predicted Effect probably null
Transcript: ENSMUST00000100461
SMART Domains Protein: ENSMUSP00000098029
Gene: ENSMUSG00000038780

DomainStartEndE-ValueType
C2 14 117 3.03e-15 SMART
low complexity region 185 193 N/A INTRINSIC
WW 235 267 1.06e-7 SMART
WW 281 313 8.66e-13 SMART
HECTc 392 728 2.72e-162 SMART
Predicted Effect probably null
Transcript: ENSMUST00000110677
SMART Domains Protein: ENSMUSP00000106305
Gene: ENSMUSG00000038780

DomainStartEndE-ValueType
C2 14 117 3.03e-15 SMART
low complexity region 185 193 N/A INTRINSIC
WW 235 267 1.06e-7 SMART
WW 307 339 8.66e-13 SMART
HECTc 418 757 3.48e-160 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183852
Predicted Effect probably benign
Transcript: ENSMUST00000198621
Meta Mutation Damage Score 0.9499 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitin ligase that is specific for receptor-regulated SMAD proteins in the bone morphogenetic protein (BMP) pathway. This protein plays a key roll in the regulation of cell motility, cell signalling, and cell polarity. Alternative splicing results in multiple transcript variants encoding different isoforms.[provided by RefSeq, Dec 2010]
PHENOTYPE: Mice homozygous for one knock-out allele display increased osteoblast function, bone density, and thickness of the cortical bone in long bones. Mice homozygous for a different knock-out allele are viable and only display gastrulation defects in combination with a Smurf2 knock-out allele. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933403O08Rik T G X: 112,240,678 M1R probably null Het
Adcy6 C T 15: 98,598,943 V482I probably damaging Het
Adgrv1 T A 13: 81,283,367 M1L probably damaging Het
Ceacam13 A G 7: 18,013,415 *264W probably null Het
D430042O09Rik A G 7: 125,820,089 N476S probably benign Het
Dennd5b A T 6: 149,101,217 D31E possibly damaging Het
Dip2c T C 13: 9,604,561 V706A probably damaging Het
Enpp3 T C 10: 24,831,732 probably null Het
Exoc4 T G 6: 33,475,997 V474G probably benign Het
F2rl1 A G 13: 95,513,211 Y388H unknown Het
Fasl T C 1: 161,781,737 R17G probably benign Het
Htr1a G A 13: 105,444,344 V31M possibly damaging Het
Inpp4b T C 8: 82,033,216 V445A probably damaging Het
Itih3 T C 14: 30,918,394 Y319C probably damaging Het
Kmt2d T C 15: 98,837,359 probably benign Het
Mobp A T 9: 120,167,967 K55* probably null Het
Ndufaf5 T A 2: 140,202,923 M279K possibly damaging Het
Nlrc3 T C 16: 3,947,875 I1057V probably benign Het
Olfr1217 G T 2: 89,023,426 H192Q probably benign Het
Olfr129 A G 17: 38,054,895 Y224H probably damaging Het
Piezo2 C T 18: 63,081,793 R1257Q probably damaging Het
Pigv A G 4: 133,665,191 S223P possibly damaging Het
Pkdcc A G 17: 83,223,953 T464A probably damaging Het
Polr2k A G 15: 36,175,047 I18V probably damaging Het
Pon3 A G 6: 5,221,578 Y351H probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Scaf8 A G 17: 3,190,249 E632G probably damaging Het
Tcrg-V5 A T 13: 19,192,524 H47L probably benign Het
Tln1 G T 4: 43,536,295 A1999D probably damaging Het
Ttn C T 2: 76,942,437 V2405I possibly damaging Het
Vps13d G A 4: 145,085,437 probably benign Het
Xrcc1 A G 7: 24,570,560 T469A probably benign Het
Zfp287 G T 11: 62,714,244 H612Q probably damaging Het
Zfp352 C T 4: 90,225,149 H509Y probably damaging Het
Other mutations in Smurf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00776:Smurf1 APN 5 144881774 missense probably benign 0.00
IGL01577:Smurf1 APN 5 144893188 missense probably damaging 0.99
IGL02232:Smurf1 APN 5 144886438 missense probably damaging 1.00
IGL02407:Smurf1 APN 5 144884724 missense probably damaging 1.00
IGL02959:Smurf1 APN 5 144899389 missense probably damaging 1.00
IGL02997:Smurf1 APN 5 144898005 nonsense probably null
IGL03227:Smurf1 APN 5 144899182 missense probably damaging 1.00
IGL03293:Smurf1 APN 5 144881799 missense probably benign
R1563:Smurf1 UTSW 5 144882513 missense probably damaging 1.00
R1652:Smurf1 UTSW 5 144880664 missense probably damaging 1.00
R2698:Smurf1 UTSW 5 144883562 unclassified probably benign
R4274:Smurf1 UTSW 5 144896775 intron probably benign
R4282:Smurf1 UTSW 5 144882593 missense probably damaging 1.00
R4287:Smurf1 UTSW 5 144891458 missense probably benign 0.00
R4643:Smurf1 UTSW 5 144879369 missense probably damaging 1.00
R4723:Smurf1 UTSW 5 144893184 missense probably damaging 1.00
R5496:Smurf1 UTSW 5 144882593 nonsense probably null
R5702:Smurf1 UTSW 5 144901211 missense possibly damaging 0.96
R5846:Smurf1 UTSW 5 144879380 missense probably damaging 1.00
R6107:Smurf1 UTSW 5 144894504 missense possibly damaging 0.75
R6263:Smurf1 UTSW 5 144881731 missense probably damaging 0.96
R6477:Smurf1 UTSW 5 144889792 missense possibly damaging 0.49
R6548:Smurf1 UTSW 5 144899497 missense probably damaging 1.00
R6584:Smurf1 UTSW 5 144882523 missense probably damaging 0.97
R6981:Smurf1 UTSW 5 144886369 missense possibly damaging 0.69
R7062:Smurf1 UTSW 5 144893546 splice site probably null
R7900:Smurf1 UTSW 5 144899373 missense probably damaging 1.00
R8271:Smurf1 UTSW 5 144894087 missense possibly damaging 0.53
R8361:Smurf1 UTSW 5 144883696 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGTGGTAAGGGCCAAATCATG -3'
(R):5'- CACTCTCTTCTGTAGGATGCCG -3'

Sequencing Primer
(F):5'- TGGTAAGGGCCAAATCATGAAAACC -3'
(R):5'- GCTGTGCCACCAGGTAGACTC -3'
Posted On2015-03-25