Incidental Mutation 'R3794:Pon3'
ID272685
Institutional Source Beutler Lab
Gene Symbol Pon3
Ensembl Gene ENSMUSG00000029759
Gene Nameparaoxonase 3
Synonyms
MMRRC Submission 040756-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3794 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location5220852-5256286 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 5221578 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 351 (Y351H)
Ref Sequence ENSEMBL: ENSMUSP00000031773 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031773] [ENSMUST00000129344]
Predicted Effect probably benign
Transcript: ENSMUST00000031773
AA Change: Y351H

PolyPhen 2 Score 0.217 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000031773
Gene: ENSMUSG00000029759
AA Change: Y351H

DomainStartEndE-ValueType
Pfam:SGL 84 304 8.8e-9 PFAM
Pfam:Arylesterase 167 252 2.5e-43 PFAM
Pfam:Str_synth 184 250 3e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129344
SMART Domains Protein: ENSMUSP00000118137
Gene: ENSMUSG00000029759

DomainStartEndE-ValueType
PDB:4HHQ|A 1 67 3e-17 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203092
Meta Mutation Damage Score 0.1062 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the paraoxonase family and lies in a cluster on chromosome 7 with the other two family members. The encoded protein is secreted into the bloodstream and associates with high-density lipoprotein (HDL). The protein also rapidly hydrolyzes lactones and can inhibit the oxidation of low-density lipoprotein (LDL), a function that is believed to slow the initiation and progression of atherosclerosis. Alternatively spliced variants which encode different protein isoforms have been described; however, only one has been fully characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a null allele show prenatal and postnatal lethality. Homozygotes for a different null allele are viable but show altered lipid and bile acid metabolism, impaired mitochondrial respiration, and increased susceptibility to diet-induced atherosclerosis, gallstone formation, and obesity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933403O08Rik T G X: 112,240,678 M1R probably null Het
Adcy6 C T 15: 98,598,943 V482I probably damaging Het
Adgrv1 T A 13: 81,283,367 M1L probably damaging Het
Ceacam13 A G 7: 18,013,415 *264W probably null Het
D430042O09Rik A G 7: 125,820,089 N476S probably benign Het
Dennd5b A T 6: 149,101,217 D31E possibly damaging Het
Dip2c T C 13: 9,604,561 V706A probably damaging Het
Enpp3 T C 10: 24,831,732 probably null Het
Exoc4 T G 6: 33,475,997 V474G probably benign Het
F2rl1 A G 13: 95,513,211 Y388H unknown Het
Fasl T C 1: 161,781,737 R17G probably benign Het
Htr1a G A 13: 105,444,344 V31M possibly damaging Het
Inpp4b T C 8: 82,033,216 V445A probably damaging Het
Itih3 T C 14: 30,918,394 Y319C probably damaging Het
Kmt2d T C 15: 98,837,359 probably benign Het
Mobp A T 9: 120,167,967 K55* probably null Het
Ndufaf5 T A 2: 140,202,923 M279K possibly damaging Het
Nlrc3 T C 16: 3,947,875 I1057V probably benign Het
Olfr1217 G T 2: 89,023,426 H192Q probably benign Het
Olfr129 A G 17: 38,054,895 Y224H probably damaging Het
Piezo2 C T 18: 63,081,793 R1257Q probably damaging Het
Pigv A G 4: 133,665,191 S223P possibly damaging Het
Pkdcc A G 17: 83,223,953 T464A probably damaging Het
Polr2k A G 15: 36,175,047 I18V probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Scaf8 A G 17: 3,190,249 E632G probably damaging Het
Smurf1 A G 5: 144,901,175 probably null Het
Tcrg-V5 A T 13: 19,192,524 H47L probably benign Het
Tln1 G T 4: 43,536,295 A1999D probably damaging Het
Ttn C T 2: 76,942,437 V2405I possibly damaging Het
Vps13d G A 4: 145,085,437 probably benign Het
Xrcc1 A G 7: 24,570,560 T469A probably benign Het
Zfp287 G T 11: 62,714,244 H612Q probably damaging Het
Zfp352 C T 4: 90,225,149 H509Y probably damaging Het
Other mutations in Pon3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01977:Pon3 APN 6 5221670 missense probably damaging 1.00
IGL01983:Pon3 APN 6 5240974 missense probably damaging 1.00
IGL02601:Pon3 APN 6 5221671 missense probably damaging 1.00
IGL02661:Pon3 APN 6 5256205 missense probably benign 0.05
IGL03168:Pon3 APN 6 5256177 missense possibly damaging 0.54
IGL02988:Pon3 UTSW 6 5232330 missense possibly damaging 0.91
R0242:Pon3 UTSW 6 5240860 missense probably benign 0.25
R0242:Pon3 UTSW 6 5240860 missense probably benign 0.25
R0566:Pon3 UTSW 6 5232408 missense possibly damaging 0.89
R0730:Pon3 UTSW 6 5230444 missense probably benign 0.18
R1378:Pon3 UTSW 6 5230813 missense probably benign 0.08
R1955:Pon3 UTSW 6 5230774 missense probably benign 0.02
R2697:Pon3 UTSW 6 5232429 missense possibly damaging 0.67
R2975:Pon3 UTSW 6 5232345 missense probably damaging 1.00
R4940:Pon3 UTSW 6 5221625 missense possibly damaging 0.75
R4988:Pon3 UTSW 6 5254582 nonsense probably null
R4990:Pon3 UTSW 6 5221619 missense probably benign
R5266:Pon3 UTSW 6 5240860 missense possibly damaging 0.66
R5473:Pon3 UTSW 6 5256177 missense possibly damaging 0.54
R6152:Pon3 UTSW 6 5221716 missense probably damaging 1.00
R6746:Pon3 UTSW 6 5230786 missense possibly damaging 0.54
R7140:Pon3 UTSW 6 5221664 missense possibly damaging 0.92
R7450:Pon3 UTSW 6 5236940 missense possibly damaging 0.80
R7853:Pon3 UTSW 6 5236911 missense probably damaging 1.00
R8481:Pon3 UTSW 6 5221715 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- AGGACACATGGGTATCTGGTTG -3'
(R):5'- GTATAGCTTTTCCTGGACAGTGC -3'

Sequencing Primer
(F):5'- ATGGGTATCTGGTTGCCACTCAC -3'
(R):5'- TCCTGGACAGTGCAGTAATG -3'
Posted On2015-03-25