Incidental Mutation 'R3794:Ceacam13'
ID272686
Institutional Source Beutler Lab
Gene Symbol Ceacam13
Ensembl Gene ENSMUSG00000057195
Gene Namecarcinoembryonic antigen-related cell adhesion molecule 13
Synonyms1600025J19Rik, Ceacam13-C2, Ceacam13-C1, 1600012K03Rik
MMRRC Submission 040756-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R3794 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location18009889-18019221 bp(+) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) A to G at 18013415 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Tryptophan at position 264 (*264W)
Ref Sequence ENSEMBL: ENSMUSP00000080404 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081703] [ENSMUST00000108488]
Predicted Effect probably null
Transcript: ENSMUST00000081703
AA Change: *264W
SMART Domains Protein: ENSMUSP00000080404
Gene: ENSMUSG00000057195
AA Change: *264W

DomainStartEndE-ValueType
IG_like 40 143 1.37e1 SMART
IG_like 158 261 8.97e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108488
SMART Domains Protein: ENSMUSP00000104128
Gene: ENSMUSG00000057195

DomainStartEndE-ValueType
IG_like 40 143 1.37e1 SMART
IG_like 158 261 8.97e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175466
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 97% (37/38)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933403O08Rik T G X: 112,240,678 M1R probably null Het
Adcy6 C T 15: 98,598,943 V482I probably damaging Het
Adgrv1 T A 13: 81,283,367 M1L probably damaging Het
D430042O09Rik A G 7: 125,820,089 N476S probably benign Het
Dennd5b A T 6: 149,101,217 D31E possibly damaging Het
Dip2c T C 13: 9,604,561 V706A probably damaging Het
Enpp3 T C 10: 24,831,732 probably null Het
Exoc4 T G 6: 33,475,997 V474G probably benign Het
F2rl1 A G 13: 95,513,211 Y388H unknown Het
Fasl T C 1: 161,781,737 R17G probably benign Het
Htr1a G A 13: 105,444,344 V31M possibly damaging Het
Inpp4b T C 8: 82,033,216 V445A probably damaging Het
Itih3 T C 14: 30,918,394 Y319C probably damaging Het
Kmt2d T C 15: 98,837,359 probably benign Het
Mobp A T 9: 120,167,967 K55* probably null Het
Ndufaf5 T A 2: 140,202,923 M279K possibly damaging Het
Nlrc3 T C 16: 3,947,875 I1057V probably benign Het
Olfr1217 G T 2: 89,023,426 H192Q probably benign Het
Olfr129 A G 17: 38,054,895 Y224H probably damaging Het
Piezo2 C T 18: 63,081,793 R1257Q probably damaging Het
Pigv A G 4: 133,665,191 S223P possibly damaging Het
Pkdcc A G 17: 83,223,953 T464A probably damaging Het
Polr2k A G 15: 36,175,047 I18V probably damaging Het
Pon3 A G 6: 5,221,578 Y351H probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Scaf8 A G 17: 3,190,249 E632G probably damaging Het
Smurf1 A G 5: 144,901,175 probably null Het
Tcrg-V5 A T 13: 19,192,524 H47L probably benign Het
Tln1 G T 4: 43,536,295 A1999D probably damaging Het
Ttn C T 2: 76,942,437 V2405I possibly damaging Het
Vps13d G A 4: 145,085,437 probably benign Het
Xrcc1 A G 7: 24,570,560 T469A probably benign Het
Zfp287 G T 11: 62,714,244 H612Q probably damaging Het
Zfp352 C T 4: 90,225,149 H509Y probably damaging Het
Other mutations in Ceacam13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00791:Ceacam13 APN 7 18013353 missense possibly damaging 0.59
IGL01617:Ceacam13 APN 7 18011383 missense possibly damaging 0.53
IGL02948:Ceacam13 APN 7 18011063 splice site probably benign
R1508:Ceacam13 UTSW 7 18011071 missense possibly damaging 0.89
R4882:Ceacam13 UTSW 7 18013072 missense probably benign 0.20
R6859:Ceacam13 UTSW 7 18013107 missense probably damaging 1.00
R8081:Ceacam13 UTSW 7 18013188 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTCAACCACTCTGGGGTATGC -3'
(R):5'- GAGCTGAGTTTGACATCATTGG -3'

Sequencing Primer
(F):5'- CCACTCTGGGGTATGCATATTATGAC -3'
(R):5'- GGACTGAGTTACCATACTACTGTC -3'
Posted On2015-03-25