Incidental Mutation 'R3794:Xrcc1'
ID272687
Institutional Source Beutler Lab
Gene Symbol Xrcc1
Ensembl Gene ENSMUSG00000051768
Gene NameX-ray repair complementing defective repair in Chinese hamster cells 1
SynonymsXrcc-1
MMRRC Submission 040756-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3794 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location24546289-24573440 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24570560 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 469 (T469A)
Ref Sequence ENSEMBL: ENSMUSP00000146105 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063249] [ENSMUST00000205573]
Predicted Effect probably benign
Transcript: ENSMUST00000063249
AA Change: T469A

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000070995
Gene: ENSMUSG00000051768
AA Change: T469A

DomainStartEndE-ValueType
Pfam:XRCC1_N 1 151 6.9e-66 PFAM
low complexity region 212 238 N/A INTRINSIC
low complexity region 278 294 N/A INTRINSIC
BRCT 317 393 8e-19 SMART
low complexity region 407 424 N/A INTRINSIC
low complexity region 444 459 N/A INTRINSIC
BRCT 538 617 5.5e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205453
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205564
Predicted Effect probably benign
Transcript: ENSMUST00000205573
AA Change: T469A

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205575
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205804
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206067
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206153
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206429
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206538
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in the efficient repair of DNA single-strand breaks formed by exposure to ionizing radiation and alkylating agents. This protein interacts with DNA ligase III, polymerase beta and poly (ADP-ribose) polymerase to participate in the base excision repair pathway. It may play a role in DNA processing during meiogenesis and recombination in germ cells. A rare microsatellite polymorphism in this gene is associated with cancer in patients of varying radiosensitivity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants accumulate unrepaired DNA strand breaks in the egg cylinder, show increased cell death in epiblast, developmental arrest at embryonic day 6.5, morphological anomalies in visceral embryonic endoderm by day 7.5 and die by day 8.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933403O08Rik T G X: 112,240,678 M1R probably null Het
Adcy6 C T 15: 98,598,943 V482I probably damaging Het
Adgrv1 T A 13: 81,283,367 M1L probably damaging Het
Ceacam13 A G 7: 18,013,415 *264W probably null Het
D430042O09Rik A G 7: 125,820,089 N476S probably benign Het
Dennd5b A T 6: 149,101,217 D31E possibly damaging Het
Dip2c T C 13: 9,604,561 V706A probably damaging Het
Enpp3 T C 10: 24,831,732 probably null Het
Exoc4 T G 6: 33,475,997 V474G probably benign Het
F2rl1 A G 13: 95,513,211 Y388H unknown Het
Fasl T C 1: 161,781,737 R17G probably benign Het
Htr1a G A 13: 105,444,344 V31M possibly damaging Het
Inpp4b T C 8: 82,033,216 V445A probably damaging Het
Itih3 T C 14: 30,918,394 Y319C probably damaging Het
Kmt2d T C 15: 98,837,359 probably benign Het
Mobp A T 9: 120,167,967 K55* probably null Het
Ndufaf5 T A 2: 140,202,923 M279K possibly damaging Het
Nlrc3 T C 16: 3,947,875 I1057V probably benign Het
Olfr1217 G T 2: 89,023,426 H192Q probably benign Het
Olfr129 A G 17: 38,054,895 Y224H probably damaging Het
Piezo2 C T 18: 63,081,793 R1257Q probably damaging Het
Pigv A G 4: 133,665,191 S223P possibly damaging Het
Pkdcc A G 17: 83,223,953 T464A probably damaging Het
Polr2k A G 15: 36,175,047 I18V probably damaging Het
Pon3 A G 6: 5,221,578 Y351H probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Scaf8 A G 17: 3,190,249 E632G probably damaging Het
Smurf1 A G 5: 144,901,175 probably null Het
Tcrg-V5 A T 13: 19,192,524 H47L probably benign Het
Tln1 G T 4: 43,536,295 A1999D probably damaging Het
Ttn C T 2: 76,942,437 V2405I possibly damaging Het
Vps13d G A 4: 145,085,437 probably benign Het
Zfp287 G T 11: 62,714,244 H612Q probably damaging Het
Zfp352 C T 4: 90,225,149 H509Y probably damaging Het
Other mutations in Xrcc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Xrcc1 APN 7 24547884 critical splice donor site probably null
IGL01830:Xrcc1 APN 7 24573342 utr 3 prime probably benign
IGL02349:Xrcc1 APN 7 24567042 nonsense probably null
IGL02433:Xrcc1 APN 7 24565554 missense possibly damaging 0.96
IGL03131:Xrcc1 APN 7 24573294 nonsense probably null
Bilberry UTSW 7 24570218 missense probably damaging 1.00
R0090:Xrcc1 UTSW 7 24570217 missense probably damaging 0.99
R0517:Xrcc1 UTSW 7 24570319 splice site probably benign
R0612:Xrcc1 UTSW 7 24570319 splice site probably benign
R1234:Xrcc1 UTSW 7 24567845 missense possibly damaging 0.71
R1577:Xrcc1 UTSW 7 24565627 nonsense probably null
R1796:Xrcc1 UTSW 7 24547827 missense probably damaging 1.00
R1863:Xrcc1 UTSW 7 24570575 missense possibly damaging 0.65
R3788:Xrcc1 UTSW 7 24566908 missense probably benign 0.08
R4806:Xrcc1 UTSW 7 24570480 missense probably benign 0.14
R5206:Xrcc1 UTSW 7 24567563 missense probably damaging 1.00
R5414:Xrcc1 UTSW 7 24570218 missense probably damaging 1.00
R5532:Xrcc1 UTSW 7 24567928 critical splice donor site probably null
R5624:Xrcc1 UTSW 7 24559845 missense possibly damaging 0.57
R5990:Xrcc1 UTSW 7 24567868 missense probably damaging 1.00
R6603:Xrcc1 UTSW 7 24571034 nonsense probably null
R6669:Xrcc1 UTSW 7 24547337 missense probably damaging 1.00
R6716:Xrcc1 UTSW 7 24567146 critical splice donor site probably null
R6881:Xrcc1 UTSW 7 24547351 nonsense probably null
R7227:Xrcc1 UTSW 7 24547332 missense probably damaging 1.00
R8204:Xrcc1 UTSW 7 24572284 missense possibly damaging 0.88
R8284:Xrcc1 UTSW 7 24572278 missense probably damaging 1.00
R8285:Xrcc1 UTSW 7 24572278 missense probably damaging 1.00
R8287:Xrcc1 UTSW 7 24572278 missense probably damaging 1.00
X0019:Xrcc1 UTSW 7 24573128 missense probably damaging 1.00
X0024:Xrcc1 UTSW 7 24573079 missense probably damaging 1.00
Z1176:Xrcc1 UTSW 7 24547839 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- ACCAGGTCTGCTGAATACCTC -3'
(R):5'- CTAGTTTTCAGGGTACACAGTGG -3'

Sequencing Primer
(F):5'- TGAATACCTCAGCTTCCTGC -3'
(R):5'- TACACAGTGGCCCCTCC -3'
Posted On2015-03-25