Mutagenetix > Incidental Mutation

Incidental Mutation 'R3794:Inpp4b'

272690

Institutional Source

Beutler Lab

Gene Symbol

Inpp4b

Ensembl Gene

ENSMUSG00000037940

Gene Name

inositol polyphosphate-4-phosphatase, type II

Synonyms

E130107I17Rik

MMRRC Submission

040756-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.207) question?

Stock #

R3794 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

81342556-82127914 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 82033216 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 445 (V445A)

Ref Sequence

ENSEMBL: ENSMUSP00000132156 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042529] [ENSMUST00000109851] [ENSMUST00000109852] [ENSMUST00000169116] [ENSMUST00000169387] [ENSMUST00000170160] [ENSMUST00000172031] [ENSMUST00000213285] [ENSMUST00000215332] [ENSMUST00000217122]

AlphaFold

Q6P1Y8

Predicted Effect

probably damaging
Transcript: ENSMUST00000042529
AA Change: V613A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000044466
Gene: ENSMUSG00000037940
AA Change: V613A

Domain	Start	End	E-Value	Type
C2	40	147	1.72e0	SMART
low complexity region	302	319	N/A	INTRINSIC
low complexity region	425	434	N/A	INTRINSIC
transmembrane domain	898	920	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000109851
AA Change: V498A

PolyPhen 2 Score 0.637 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000105477
Gene: ENSMUSG00000037940
AA Change: V498A

Domain	Start	End	E-Value	Type
low complexity region	22	35	N/A	INTRINSIC
low complexity region	187	204	N/A	INTRINSIC
low complexity region	310	319	N/A	INTRINSIC
transmembrane domain	783	805	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000109852
AA Change: V630A

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000105478
Gene: ENSMUSG00000037940
AA Change: V630A

Domain	Start	End	E-Value	Type
C2	40	164	5.29e0	SMART
low complexity region	319	336	N/A	INTRINSIC
low complexity region	442	451	N/A	INTRINSIC
transmembrane domain	915	937	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000169116
AA Change: V630A

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000131947
Gene: ENSMUSG00000037940
AA Change: V630A

Domain	Start	End	E-Value	Type
C2	40	164	5.29e0	SMART
low complexity region	319	336	N/A	INTRINSIC
low complexity region	442	451	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000169387

Predicted Effect

probably damaging
Transcript: ENSMUST00000170160
AA Change: V445A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000132156
Gene: ENSMUSG00000037940
AA Change: V445A

Domain	Start	End	E-Value	Type
low complexity region	134	151	N/A	INTRINSIC
low complexity region	257	266	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000172031
AA Change: V630A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000131324
Gene: ENSMUSG00000037940
AA Change: V630A

Domain	Start	End	E-Value	Type
C2	40	164	5.29e0	SMART
low complexity region	319	336	N/A	INTRINSIC
low complexity region	442	451	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000213285
AA Change: V630A

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)

Predicted Effect

probably damaging
Transcript: ENSMUST00000215332
AA Change: V630A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

Predicted Effect

probably damaging
Transcript: ENSMUST00000217122
AA Change: V630A

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)

Meta Mutation Damage Score

0.4347

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.4%

Validation Efficiency

97% (37/38)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] INPP4B encodes the inositol polyphosphate 4-phosphatase type II, one of the enzymes involved in phosphatidylinositol signaling pathways. This enzyme removes the phosphate group at position 4 of the inositol ring from inositol 3,4-bisphosphate. There is limited data to suggest that the human type II enzyme is subject to alternative splicing, as has been established for the type I enzyme. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit osteoporosis, reduced long bone length, increased osteoclast numbers and size, increased osteoblast numbers, and increased bone resorption and resorption. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933403O08Rik	T	G	X: 112,240,678	M1R	probably null	Het
Adcy6	C	T	15: 98,598,943	V482I	probably damaging	Het
Adgrv1	T	A	13: 81,283,367	M1L	probably damaging	Het
Ceacam13	A	G	7: 18,013,415	*264W	probably null	Het
D430042O09Rik	A	G	7: 125,820,089	N476S	probably benign	Het
Dennd5b	A	T	6: 149,101,217	D31E	possibly damaging	Het
Dip2c	T	C	13: 9,604,561	V706A	probably damaging	Het
Enpp3	T	C	10: 24,831,732		probably null	Het
Exoc4	T	G	6: 33,475,997	V474G	probably benign	Het
F2rl1	A	G	13: 95,513,211	Y388H	unknown	Het
Fasl	T	C	1: 161,781,737	R17G	probably benign	Het
Htr1a	G	A	13: 105,444,344	V31M	possibly damaging	Het
Itih3	T	C	14: 30,918,394	Y319C	probably damaging	Het
Kmt2d	T	C	15: 98,837,359		probably benign	Het
Mobp	A	T	9: 120,167,967	K55*	probably null	Het
Ndufaf5	T	A	2: 140,202,923	M279K	possibly damaging	Het
Nlrc3	T	C	16: 3,947,875	I1057V	probably benign	Het
Olfr1217	G	T	2: 89,023,426	H192Q	probably benign	Het
Olfr129	A	G	17: 38,054,895	Y224H	probably damaging	Het
Piezo2	C	T	18: 63,081,793	R1257Q	probably damaging	Het
Pigv	A	G	4: 133,665,191	S223P	possibly damaging	Het
Pkdcc	A	G	17: 83,223,953	T464A	probably damaging	Het
Polr2k	A	G	15: 36,175,047	I18V	probably damaging	Het
Pon3	A	G	6: 5,221,578	Y351H	probably benign	Het
Rsf1	ATGGCG	ATGGCGACGGTGGCG	7: 97,579,904		probably benign	Het
Scaf8	A	G	17: 3,190,249	E632G	probably damaging	Het
Smurf1	A	G	5: 144,901,175		probably null	Het
Tcrg-V5	A	T	13: 19,192,524	H47L	probably benign	Het
Tln1	G	T	4: 43,536,295	A1999D	probably damaging	Het
Ttn	C	T	2: 76,942,437	V2405I	possibly damaging	Het
Vps13d	G	A	4: 145,085,437		probably benign	Het
Xrcc1	A	G	7: 24,570,560	T469A	probably benign	Het
Zfp287	G	T	11: 62,714,244	H612Q	probably damaging	Het
Zfp352	C	T	4: 90,225,149	H509Y	probably damaging	Het

Other mutations in Inpp4b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00850:Inpp4b	APN	8	81856750	missense	probably damaging	1.00
IGL01481:Inpp4b	APN	8	81997380	missense	probably damaging	1.00
IGL01509:Inpp4b	APN	8	81890703	splice site	probably benign
IGL01515:Inpp4b	APN	8	81952711	missense	possibly damaging	0.68
IGL01607:Inpp4b	APN	8	82010663	missense	probably benign	0.03
IGL01643:Inpp4b	APN	8	82071771	missense	probably damaging	0.97
IGL01736:Inpp4b	APN	8	81997339	missense	probably benign	0.00
IGL02154:Inpp4b	APN	8	81969501	splice site	probably benign
IGL02327:Inpp4b	APN	8	82041962	missense	probably benign	0.01
IGL02413:Inpp4b	APN	8	82033171	missense	probably benign
IGL02652:Inpp4b	APN	8	81770800	splice site	probably benign
IGL02678:Inpp4b	APN	8	81856744	missense	probably damaging	1.00
IGL03146:Inpp4b	APN	8	81743781	missense	possibly damaging	0.61
LCD18:Inpp4b	UTSW	8	81693010	intron	probably benign
PIT4280001:Inpp4b	UTSW	8	82034417	missense	probably benign	0.00
PIT4480001:Inpp4b	UTSW	8	82046267	missense	probably damaging	1.00
PIT4504001:Inpp4b	UTSW	8	82041935	missense	probably damaging	1.00
R0083:Inpp4b	UTSW	8	81741462	missense	possibly damaging	0.77
R0212:Inpp4b	UTSW	8	81770917	missense	probably benign	0.00
R0285:Inpp4b	UTSW	8	82034516	splice site	probably benign
R0363:Inpp4b	UTSW	8	81884257	splice site	probably benign
R0364:Inpp4b	UTSW	8	81997314	missense	probably benign	0.09
R0471:Inpp4b	UTSW	8	82041899	missense	possibly damaging	0.94
R0550:Inpp4b	UTSW	8	81997337	missense	probably benign	0.00
R0562:Inpp4b	UTSW	8	81768151	missense	possibly damaging	0.88
R0661:Inpp4b	UTSW	8	81741462	missense	possibly damaging	0.77
R0693:Inpp4b	UTSW	8	81997314	missense	probably benign	0.09
R1081:Inpp4b	UTSW	8	82069024	missense	probably damaging	0.97
R1251:Inpp4b	UTSW	8	81890753	missense	probably benign	0.01
R1374:Inpp4b	UTSW	8	81743816	critical splice donor site	probably null
R1445:Inpp4b	UTSW	8	81952834	splice site	probably null
R1465:Inpp4b	UTSW	8	81768157	missense	probably damaging	1.00
R1465:Inpp4b	UTSW	8	81768157	missense	probably damaging	1.00
R1647:Inpp4b	UTSW	8	81856774	splice site	probably benign
R1754:Inpp4b	UTSW	8	81770811	missense	probably damaging	1.00
R1759:Inpp4b	UTSW	8	81768103	missense	probably benign	0.06
R2085:Inpp4b	UTSW	8	81952274	missense	probably damaging	1.00
R2156:Inpp4b	UTSW	8	82048489	missense	probably damaging	1.00
R2160:Inpp4b	UTSW	8	82121375	nonsense	probably null
R2175:Inpp4b	UTSW	8	81856699	missense	probably damaging	1.00
R2191:Inpp4b	UTSW	8	81997302	missense	probably damaging	1.00
R2401:Inpp4b	UTSW	8	81997339	missense	probably benign	0.00
R2475:Inpp4b	UTSW	8	82041978	missense	probably benign	0.09
R2512:Inpp4b	UTSW	8	82010550	missense	probably damaging	1.00
R2919:Inpp4b	UTSW	8	81985329	missense	possibly damaging	0.93
R3021:Inpp4b	UTSW	8	81902838	missense	possibly damaging	0.47
R3423:Inpp4b	UTSW	8	81952261	missense	possibly damaging	0.63
R3777:Inpp4b	UTSW	8	82041992	missense	possibly damaging	0.89
R3778:Inpp4b	UTSW	8	82041992	missense	possibly damaging	0.89
R3795:Inpp4b	UTSW	8	82033216	missense	probably damaging	1.00
R4590:Inpp4b	UTSW	8	81741411	start codon destroyed	probably null	1.00
R4602:Inpp4b	UTSW	8	81969535	missense	probably damaging	0.99
R4691:Inpp4b	UTSW	8	82122653	missense	probably damaging	1.00
R4924:Inpp4b	UTSW	8	82122624	missense	probably damaging	1.00
R4992:Inpp4b	UTSW	8	82033208	missense	probably damaging	1.00
R5219:Inpp4b	UTSW	8	81884156	missense	probably benign	0.01
R5228:Inpp4b	UTSW	8	81768115	missense	probably damaging	0.99
R5557:Inpp4b	UTSW	8	81952259	missense	probably damaging	0.99
R5627:Inpp4b	UTSW	8	81743816	critical splice donor site	probably benign
R5691:Inpp4b	UTSW	8	81890694	intron	probably benign
R6186:Inpp4b	UTSW	8	82046234	missense	probably damaging	0.99
R6213:Inpp4b	UTSW	8	81997390	missense	probably damaging	1.00
R6232:Inpp4b	UTSW	8	81952184	missense	probably damaging	1.00
R6283:Inpp4b	UTSW	8	81770833	missense	probably damaging	1.00
R6302:Inpp4b	UTSW	8	81768177	missense	probably benign	0.00
R6309:Inpp4b	UTSW	8	82041917	missense	probably damaging	1.00
R6360:Inpp4b	UTSW	8	81902852	missense	probably benign	0.20
R6477:Inpp4b	UTSW	8	81844714	splice site	probably null
R6773:Inpp4b	UTSW	8	81856620	intron	probably benign
R6968:Inpp4b	UTSW	8	81844457	missense	probably benign	0.18
R7147:Inpp4b	UTSW	8	81902771	missense	probably damaging	1.00
R7318:Inpp4b	UTSW	8	82071745	missense	probably damaging	1.00
R7409:Inpp4b	UTSW	8	81952685	splice site	probably null
R7455:Inpp4b	UTSW	8	82071703	missense	probably damaging	0.99
R7632:Inpp4b	UTSW	8	82046339	missense	probably damaging	1.00
R7844:Inpp4b	UTSW	8	81741320	start gained	probably benign
R7958:Inpp4b	UTSW	8	81969589	missense	probably damaging	1.00
R8440:Inpp4b	UTSW	8	82041895	missense	probably damaging	1.00
R9160:Inpp4b	UTSW	8	81884153	missense	possibly damaging	0.55
R9303:Inpp4b	UTSW	8	82033129	missense	probably damaging	1.00
R9390:Inpp4b	UTSW	8	81770893	missense	probably damaging	1.00
R9583:Inpp4b	UTSW	8	81770926	critical splice donor site	probably null
RF003:Inpp4b	UTSW	8	81969521	nonsense	probably null
Z1088:Inpp4b	UTSW	8	82068931	critical splice acceptor site	probably null
Z1176:Inpp4b	UTSW	8	82069001	missense	possibly damaging	0.60

Predicted Primers

PCR Primer
(F):5'- TCCATATGCCCTGCCACAG -3'
(R):5'- CAGACTCCATCCACTGTTCAAG -3'

Sequencing Primer
(F):5'- TATGCCCTGCCACAGAGGAC -3'
(R):5'- GAAATTGTTCATGATCTAGTCAGCC -3'

Posted On

2015-03-25