Incidental Mutation 'R3794:Zfp287'
ID272693
Institutional Source Beutler Lab
Gene Symbol Zfp287
Ensembl Gene ENSMUSG00000005267
Gene Namezinc finger protein 287
SynonymsB230333C16Rik, SKAT-2
MMRRC Submission 040756-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3794 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location62700356-62731905 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 62714244 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 612 (H612Q)
Ref Sequence ENSEMBL: ENSMUSP00000141046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005399] [ENSMUST00000149228] [ENSMUST00000150336] [ENSMUST00000185656]
Predicted Effect probably damaging
Transcript: ENSMUST00000005399
AA Change: H601Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000005399
Gene: ENSMUSG00000005267
AA Change: H601Q

DomainStartEndE-ValueType
SCAN 27 138 1e-50 SMART
KRAB 155 212 5.79e-20 SMART
low complexity region 253 262 N/A INTRINSIC
ZnF_C2H2 355 377 5.9e-3 SMART
ZnF_C2H2 383 405 2.61e-4 SMART
ZnF_C2H2 411 433 5.59e-4 SMART
ZnF_C2H2 439 461 3.44e-4 SMART
ZnF_C2H2 467 489 9.73e-4 SMART
ZnF_C2H2 495 517 2.43e-4 SMART
ZnF_C2H2 523 545 4.54e-4 SMART
ZnF_C2H2 551 573 2.57e-3 SMART
ZnF_C2H2 579 601 4.87e-4 SMART
ZnF_C2H2 607 629 1.3e-4 SMART
ZnF_C2H2 635 657 4.79e-3 SMART
ZnF_C2H2 663 685 2.95e-3 SMART
ZnF_C2H2 691 713 3.63e-3 SMART
ZnF_C2H2 719 741 1.38e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000149228
AA Change: H612Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114531
Gene: ENSMUSG00000005267
AA Change: H612Q

DomainStartEndE-ValueType
SCAN 38 149 1e-50 SMART
KRAB 166 223 5.79e-20 SMART
low complexity region 264 273 N/A INTRINSIC
ZnF_C2H2 366 388 5.9e-3 SMART
ZnF_C2H2 394 416 2.61e-4 SMART
ZnF_C2H2 422 444 5.59e-4 SMART
ZnF_C2H2 450 472 3.44e-4 SMART
ZnF_C2H2 478 500 9.73e-4 SMART
ZnF_C2H2 506 528 2.43e-4 SMART
ZnF_C2H2 534 556 4.54e-4 SMART
ZnF_C2H2 562 584 2.57e-3 SMART
ZnF_C2H2 590 612 4.87e-4 SMART
ZnF_C2H2 618 640 1.3e-4 SMART
ZnF_C2H2 646 668 4.79e-3 SMART
ZnF_C2H2 674 696 2.95e-3 SMART
ZnF_C2H2 702 724 3.63e-3 SMART
ZnF_C2H2 730 752 1.38e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000150336
SMART Domains Protein: ENSMUSP00000121717
Gene: ENSMUSG00000005267

DomainStartEndE-ValueType
SCAN 38 149 1e-50 SMART
KRAB 166 223 5.79e-20 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000185656
AA Change: H612Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141046
Gene: ENSMUSG00000005267
AA Change: H612Q

DomainStartEndE-ValueType
SCAN 38 149 1e-50 SMART
KRAB 166 223 5.79e-20 SMART
low complexity region 264 273 N/A INTRINSIC
ZnF_C2H2 366 388 5.9e-3 SMART
ZnF_C2H2 394 416 2.61e-4 SMART
ZnF_C2H2 422 444 5.59e-4 SMART
ZnF_C2H2 450 472 3.44e-4 SMART
ZnF_C2H2 478 500 9.73e-4 SMART
ZnF_C2H2 506 528 2.43e-4 SMART
ZnF_C2H2 534 556 4.54e-4 SMART
ZnF_C2H2 562 584 2.57e-3 SMART
ZnF_C2H2 590 612 4.87e-4 SMART
ZnF_C2H2 618 640 1.3e-4 SMART
ZnF_C2H2 646 668 4.79e-3 SMART
ZnF_C2H2 674 696 2.95e-3 SMART
ZnF_C2H2 702 724 3.63e-3 SMART
ZnF_C2H2 730 752 1.38e-3 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the krueppel family of zinc finger proteins, suggesting a role as a transcription factor. Its specific function has not been determined. This gene is located near the Smith-Magenis syndrome region on chromosome 17. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933403O08Rik T G X: 112,240,678 M1R probably null Het
Adcy6 C T 15: 98,598,943 V482I probably damaging Het
Adgrv1 T A 13: 81,283,367 M1L probably damaging Het
Ceacam13 A G 7: 18,013,415 *264W probably null Het
D430042O09Rik A G 7: 125,820,089 N476S probably benign Het
Dennd5b A T 6: 149,101,217 D31E possibly damaging Het
Dip2c T C 13: 9,604,561 V706A probably damaging Het
Enpp3 T C 10: 24,831,732 probably null Het
Exoc4 T G 6: 33,475,997 V474G probably benign Het
F2rl1 A G 13: 95,513,211 Y388H unknown Het
Fasl T C 1: 161,781,737 R17G probably benign Het
Htr1a G A 13: 105,444,344 V31M possibly damaging Het
Inpp4b T C 8: 82,033,216 V445A probably damaging Het
Itih3 T C 14: 30,918,394 Y319C probably damaging Het
Kmt2d T C 15: 98,837,359 probably benign Het
Mobp A T 9: 120,167,967 K55* probably null Het
Ndufaf5 T A 2: 140,202,923 M279K possibly damaging Het
Nlrc3 T C 16: 3,947,875 I1057V probably benign Het
Olfr1217 G T 2: 89,023,426 H192Q probably benign Het
Olfr129 A G 17: 38,054,895 Y224H probably damaging Het
Piezo2 C T 18: 63,081,793 R1257Q probably damaging Het
Pigv A G 4: 133,665,191 S223P possibly damaging Het
Pkdcc A G 17: 83,223,953 T464A probably damaging Het
Polr2k A G 15: 36,175,047 I18V probably damaging Het
Pon3 A G 6: 5,221,578 Y351H probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Scaf8 A G 17: 3,190,249 E632G probably damaging Het
Smurf1 A G 5: 144,901,175 probably null Het
Tcrg-V5 A T 13: 19,192,524 H47L probably benign Het
Tln1 G T 4: 43,536,295 A1999D probably damaging Het
Ttn C T 2: 76,942,437 V2405I possibly damaging Het
Vps13d G A 4: 145,085,437 probably benign Het
Xrcc1 A G 7: 24,570,560 T469A probably benign Het
Zfp352 C T 4: 90,225,149 H509Y probably damaging Het
Other mutations in Zfp287
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01084:Zfp287 APN 11 62713890 nonsense probably null
IGL01868:Zfp287 APN 11 62715257 missense probably benign 0.22
IGL03290:Zfp287 APN 11 62715236 missense probably damaging 0.98
R0064:Zfp287 UTSW 11 62714938 missense possibly damaging 0.68
R0064:Zfp287 UTSW 11 62714938 missense possibly damaging 0.68
R0193:Zfp287 UTSW 11 62715029 missense probably benign 0.12
R0211:Zfp287 UTSW 11 62714917 missense probably damaging 0.99
R0211:Zfp287 UTSW 11 62714917 missense probably damaging 0.99
R0525:Zfp287 UTSW 11 62715244 missense probably benign
R0725:Zfp287 UTSW 11 62714213 missense probably damaging 1.00
R1405:Zfp287 UTSW 11 62728311 missense probably damaging 1.00
R1405:Zfp287 UTSW 11 62728311 missense probably damaging 1.00
R1416:Zfp287 UTSW 11 62714340 missense probably damaging 1.00
R1487:Zfp287 UTSW 11 62725289 missense probably damaging 1.00
R2023:Zfp287 UTSW 11 62714982 nonsense probably null
R2045:Zfp287 UTSW 11 62727569 missense probably damaging 1.00
R2495:Zfp287 UTSW 11 62714633 missense probably damaging 1.00
R3902:Zfp287 UTSW 11 62712202 missense probably benign 0.00
R4816:Zfp287 UTSW 11 62714248 missense probably damaging 1.00
R4928:Zfp287 UTSW 11 62714136 nonsense probably null
R5048:Zfp287 UTSW 11 62714951 missense probably damaging 0.98
R5858:Zfp287 UTSW 11 62714007 missense probably damaging 1.00
R6349:Zfp287 UTSW 11 62725342 missense probably damaging 0.99
R6964:Zfp287 UTSW 11 62724817 missense probably damaging 1.00
R7024:Zfp287 UTSW 11 62714938 missense possibly damaging 0.68
R7252:Zfp287 UTSW 11 62724829 missense probably damaging 1.00
R7318:Zfp287 UTSW 11 62714278 missense probably damaging 1.00
R7548:Zfp287 UTSW 11 62713875 nonsense probably null
R7658:Zfp287 UTSW 11 62725263 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCCGTTGGTGCTGAGTC -3'
(R):5'- AAGAATTTAAGCATCTCTCCTCCC -3'

Sequencing Primer
(F):5'- TGAGTCAGGTTTGCACCC -3'
(R):5'- CTGGAGTGCAGTAAAACCTTTAGCC -3'
Posted On2015-03-25