Mutagenetix > Incidental Mutations

Incidental Mutation 'R3794:Itih3'

272698

Institutional Source

Beutler Lab

Gene Symbol

Itih3

Ensembl Gene

ENSMUSG00000006522

Gene Name

inter-alpha trypsin inhibitor, heavy chain 3

Synonyms

Itih-3, Intin3

MMRRC Submission

040756-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.055) question?

Stock #

R3794 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

30908572-30923760 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 30918394 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 319 (Y319C)

Ref Sequence

ENSEMBL: ENSMUSP00000006697 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006697] [ENSMUST00000226547] [ENSMUST00000227995] [ENSMUST00000228114]

Predicted Effect

probably damaging
Transcript: ENSMUST00000006697
AA Change: Y319C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000006697
Gene: ENSMUSG00000006522
AA Change: Y319C

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
VIT	29	158	3.87e-83	SMART
VWA	282	466	1.19e-29	SMART
Blast:VWA	571	634	2e-21	BLAST
Pfam:ITI_HC_C	683	870	3e-73	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000112141

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000169620

Predicted Effect

probably damaging
Transcript: ENSMUST00000170415
AA Change: Y319C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000133027
Gene: ENSMUSG00000006522
AA Change: Y319C

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
VIT	29	158	3.87e-83	SMART
VWA	282	466	1.19e-29	SMART
Pfam:ITI_HC_C	503	680	1.5e-67	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000226179

Predicted Effect

probably benign
Transcript: ENSMUST00000226547

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227181

Predicted Effect

probably damaging
Transcript: ENSMUST00000227995
AA Change: Y319C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

Predicted Effect

probably benign
Transcript: ENSMUST00000228114

Meta Mutation Damage Score

0.4538

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.4%

Validation Efficiency

97% (37/38)

MGI Phenotype

FUNCTION: This gene encodes one of the heavy subunits of inter alpha trypsin inhibitor that functions as a protease inhibitor circulating in the plasma. The encoded protein undergoes proteolytic processing to generate a mature glycoprotein that is linked to the other subunits via an ester bond between the C-terminal aspartic acid residue and the N-acetyl galactosamine residue of chondroitin sulfate. This gene is located in a cluster of related inter alpha trypsin inhibitor genes on chromosome 14. [provided by RefSeq, Oct 2015]

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933403O08Rik	T	G	X: 112,240,678	M1R	probably null	Het
Adcy6	C	T	15: 98,598,943	V482I	probably damaging	Het
Adgrv1	T	A	13: 81,283,367	M1L	probably damaging	Het
Ceacam13	A	G	7: 18,013,415	*264W	probably null	Het
D430042O09Rik	A	G	7: 125,820,089	N476S	probably benign	Het
Dennd5b	A	T	6: 149,101,217	D31E	possibly damaging	Het
Dip2c	T	C	13: 9,604,561	V706A	probably damaging	Het
Enpp3	T	C	10: 24,831,732		probably null	Het
Exoc4	T	G	6: 33,475,997	V474G	probably benign	Het
F2rl1	A	G	13: 95,513,211	Y388H	unknown	Het
Fasl	T	C	1: 161,781,737	R17G	probably benign	Het
Htr1a	G	A	13: 105,444,344	V31M	possibly damaging	Het
Inpp4b	T	C	8: 82,033,216	V445A	probably damaging	Het
Kmt2d	T	C	15: 98,837,359		probably benign	Het
Mobp	A	T	9: 120,167,967	K55*	probably null	Het
Ndufaf5	T	A	2: 140,202,923	M279K	possibly damaging	Het
Nlrc3	T	C	16: 3,947,875	I1057V	probably benign	Het
Olfr1217	G	T	2: 89,023,426	H192Q	probably benign	Het
Olfr129	A	G	17: 38,054,895	Y224H	probably damaging	Het
Piezo2	C	T	18: 63,081,793	R1257Q	probably damaging	Het
Pigv	A	G	4: 133,665,191	S223P	possibly damaging	Het
Pkdcc	A	G	17: 83,223,953	T464A	probably damaging	Het
Polr2k	A	G	15: 36,175,047	I18V	probably damaging	Het
Pon3	A	G	6: 5,221,578	Y351H	probably benign	Het
Rsf1	ATGGCG	ATGGCGACGGTGGCG	7: 97,579,904		probably benign	Het
Scaf8	A	G	17: 3,190,249	E632G	probably damaging	Het
Smurf1	A	G	5: 144,901,175		probably null	Het
Tcrg-V5	A	T	13: 19,192,524	H47L	probably benign	Het
Tln1	G	T	4: 43,536,295	A1999D	probably damaging	Het
Ttn	C	T	2: 76,942,437	V2405I	possibly damaging	Het
Vps13d	G	A	4: 145,085,437		probably benign	Het
Xrcc1	A	G	7: 24,570,560	T469A	probably benign	Het
Zfp287	G	T	11: 62,714,244	H612Q	probably damaging	Het
Zfp352	C	T	4: 90,225,149	H509Y	probably damaging	Het

Other mutations in Itih3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01092:Itih3	APN	14	30909781	missense	probably damaging	0.98
IGL01359:Itih3	APN	14	30917772	missense	probably damaging	1.00
IGL01965:Itih3	APN	14	30915720	missense	probably damaging	0.99
IGL02435:Itih3	APN	14	30915754	missense	probably damaging	0.99
IGL02539:Itih3	APN	14	30912664	missense	probably benign	0.03
IGL02637:Itih3	APN	14	30915660	missense	probably benign	0.00
IGL02958:Itih3	APN	14	30913182	missense	probably benign	0.00
IGL03253:Itih3	APN	14	30911923	critical splice donor site	probably null
K2124:Itih3	UTSW	14	30912687	missense	probably benign	0.40
R0321:Itih3	UTSW	14	30912106	missense	probably damaging	0.99
R0466:Itih3	UTSW	14	30912874	critical splice donor site	probably null
R1402:Itih3	UTSW	14	30908708	missense	probably damaging	1.00
R1402:Itih3	UTSW	14	30908708	missense	probably damaging	1.00
R1633:Itih3	UTSW	14	30917398	missense	possibly damaging	0.46
R1982:Itih3	UTSW	14	30923583	unclassified	probably benign
R2056:Itih3	UTSW	14	30909524	splice site	probably null
R2077:Itih3	UTSW	14	30909835	missense	possibly damaging	0.91
R2417:Itih3	UTSW	14	30917664	missense	probably benign	0.04
R3624:Itih3	UTSW	14	30914743	missense	probably damaging	1.00
R4676:Itih3	UTSW	14	30918949	missense	probably null	1.00
R4676:Itih3	UTSW	14	30921686	missense	possibly damaging	0.91
R5198:Itih3	UTSW	14	30912649	missense	probably benign	0.07
R5429:Itih3	UTSW	14	30923521	missense	probably benign	0.00
R6379:Itih3	UTSW	14	30909724	missense	probably damaging	1.00
R6740:Itih3	UTSW	14	30912687	missense	probably benign	0.40
R6752:Itih3	UTSW	14	30923489	missense	possibly damaging	0.76
R6765:Itih3	UTSW	14	30909473	missense	probably benign
R6785:Itih3	UTSW	14	30912615	critical splice donor site	probably null
R6871:Itih3	UTSW	14	30912687	missense	probably benign	0.40
R6935:Itih3	UTSW	14	30912702	missense	possibly damaging	0.82
R7133:Itih3	UTSW	14	30917698	missense	probably damaging	1.00
R7419:Itih3	UTSW	14	30914773	missense	probably benign	0.41
R7592:Itih3	UTSW	14	30908765	missense	probably damaging	0.98
R7598:Itih3	UTSW	14	30917377	missense	possibly damaging	0.95
R7662:Itih3	UTSW	14	30917330	missense	probably benign	0.00
R8183:Itih3	UTSW	14	30909476	missense	probably benign
Y5408:Itih3	UTSW	14	30921945	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAGTCTGAGGTCTACCCCAAGG -3'
(R):5'- AGCTTTTACCCACTTCCACAGG -3'

Sequencing Primer
(F):5'- CCCAAGGGAGAGACACAAAG -3'
(R):5'- TCCACAGGGAATTGGGGGC -3'

Posted On

2015-03-25