Incidental Mutation 'R3794:Itih3'
ID272698
Institutional Source Beutler Lab
Gene Symbol Itih3
Ensembl Gene ENSMUSG00000006522
Gene Nameinter-alpha trypsin inhibitor, heavy chain 3
SynonymsItih-3, Intin3
MMRRC Submission 040756-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R3794 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location30908572-30923760 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 30918394 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 319 (Y319C)
Ref Sequence ENSEMBL: ENSMUSP00000006697 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006697] [ENSMUST00000226547] [ENSMUST00000227995] [ENSMUST00000228114]
Predicted Effect probably damaging
Transcript: ENSMUST00000006697
AA Change: Y319C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000006697
Gene: ENSMUSG00000006522
AA Change: Y319C

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
VIT 29 158 3.87e-83 SMART
VWA 282 466 1.19e-29 SMART
Blast:VWA 571 634 2e-21 BLAST
Pfam:ITI_HC_C 683 870 3e-73 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000112141
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169620
Predicted Effect probably damaging
Transcript: ENSMUST00000170415
AA Change: Y319C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000133027
Gene: ENSMUSG00000006522
AA Change: Y319C

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
VIT 29 158 3.87e-83 SMART
VWA 282 466 1.19e-29 SMART
Pfam:ITI_HC_C 503 680 1.5e-67 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226179
Predicted Effect probably benign
Transcript: ENSMUST00000226547
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227181
Predicted Effect probably damaging
Transcript: ENSMUST00000227995
AA Change: Y319C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably benign
Transcript: ENSMUST00000228114
Meta Mutation Damage Score 0.4538 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: This gene encodes one of the heavy subunits of inter alpha trypsin inhibitor that functions as a protease inhibitor circulating in the plasma. The encoded protein undergoes proteolytic processing to generate a mature glycoprotein that is linked to the other subunits via an ester bond between the C-terminal aspartic acid residue and the N-acetyl galactosamine residue of chondroitin sulfate. This gene is located in a cluster of related inter alpha trypsin inhibitor genes on chromosome 14. [provided by RefSeq, Oct 2015]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933403O08Rik T G X: 112,240,678 M1R probably null Het
Adcy6 C T 15: 98,598,943 V482I probably damaging Het
Adgrv1 T A 13: 81,283,367 M1L probably damaging Het
Ceacam13 A G 7: 18,013,415 *264W probably null Het
D430042O09Rik A G 7: 125,820,089 N476S probably benign Het
Dennd5b A T 6: 149,101,217 D31E possibly damaging Het
Dip2c T C 13: 9,604,561 V706A probably damaging Het
Enpp3 T C 10: 24,831,732 probably null Het
Exoc4 T G 6: 33,475,997 V474G probably benign Het
F2rl1 A G 13: 95,513,211 Y388H unknown Het
Fasl T C 1: 161,781,737 R17G probably benign Het
Htr1a G A 13: 105,444,344 V31M possibly damaging Het
Inpp4b T C 8: 82,033,216 V445A probably damaging Het
Kmt2d T C 15: 98,837,359 probably benign Het
Mobp A T 9: 120,167,967 K55* probably null Het
Ndufaf5 T A 2: 140,202,923 M279K possibly damaging Het
Nlrc3 T C 16: 3,947,875 I1057V probably benign Het
Olfr1217 G T 2: 89,023,426 H192Q probably benign Het
Olfr129 A G 17: 38,054,895 Y224H probably damaging Het
Piezo2 C T 18: 63,081,793 R1257Q probably damaging Het
Pigv A G 4: 133,665,191 S223P possibly damaging Het
Pkdcc A G 17: 83,223,953 T464A probably damaging Het
Polr2k A G 15: 36,175,047 I18V probably damaging Het
Pon3 A G 6: 5,221,578 Y351H probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Scaf8 A G 17: 3,190,249 E632G probably damaging Het
Smurf1 A G 5: 144,901,175 probably null Het
Tcrg-V5 A T 13: 19,192,524 H47L probably benign Het
Tln1 G T 4: 43,536,295 A1999D probably damaging Het
Ttn C T 2: 76,942,437 V2405I possibly damaging Het
Vps13d G A 4: 145,085,437 probably benign Het
Xrcc1 A G 7: 24,570,560 T469A probably benign Het
Zfp287 G T 11: 62,714,244 H612Q probably damaging Het
Zfp352 C T 4: 90,225,149 H509Y probably damaging Het
Other mutations in Itih3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01092:Itih3 APN 14 30909781 missense probably damaging 0.98
IGL01359:Itih3 APN 14 30917772 missense probably damaging 1.00
IGL01965:Itih3 APN 14 30915720 missense probably damaging 0.99
IGL02435:Itih3 APN 14 30915754 missense probably damaging 0.99
IGL02539:Itih3 APN 14 30912664 missense probably benign 0.03
IGL02637:Itih3 APN 14 30915660 missense probably benign 0.00
IGL02958:Itih3 APN 14 30913182 missense probably benign 0.00
IGL03253:Itih3 APN 14 30911923 critical splice donor site probably null
K2124:Itih3 UTSW 14 30912687 missense probably benign 0.40
R0321:Itih3 UTSW 14 30912106 missense probably damaging 0.99
R0466:Itih3 UTSW 14 30912874 critical splice donor site probably null
R1402:Itih3 UTSW 14 30908708 missense probably damaging 1.00
R1402:Itih3 UTSW 14 30908708 missense probably damaging 1.00
R1633:Itih3 UTSW 14 30917398 missense possibly damaging 0.46
R1982:Itih3 UTSW 14 30923583 unclassified probably benign
R2056:Itih3 UTSW 14 30909524 splice site probably null
R2077:Itih3 UTSW 14 30909835 missense possibly damaging 0.91
R2417:Itih3 UTSW 14 30917664 missense probably benign 0.04
R3624:Itih3 UTSW 14 30914743 missense probably damaging 1.00
R4676:Itih3 UTSW 14 30918949 missense probably null 1.00
R4676:Itih3 UTSW 14 30921686 missense possibly damaging 0.91
R5198:Itih3 UTSW 14 30912649 missense probably benign 0.07
R5429:Itih3 UTSW 14 30923521 missense probably benign 0.00
R6379:Itih3 UTSW 14 30909724 missense probably damaging 1.00
R6740:Itih3 UTSW 14 30912687 missense probably benign 0.40
R6752:Itih3 UTSW 14 30923489 missense possibly damaging 0.76
R6765:Itih3 UTSW 14 30909473 missense probably benign
R6785:Itih3 UTSW 14 30912615 critical splice donor site probably null
R6871:Itih3 UTSW 14 30912687 missense probably benign 0.40
R6935:Itih3 UTSW 14 30912702 missense possibly damaging 0.82
R7133:Itih3 UTSW 14 30917698 missense probably damaging 1.00
R7419:Itih3 UTSW 14 30914773 missense probably benign 0.41
R7592:Itih3 UTSW 14 30908765 missense probably damaging 0.98
R7598:Itih3 UTSW 14 30917377 missense possibly damaging 0.95
R7662:Itih3 UTSW 14 30917330 missense probably benign 0.00
R8183:Itih3 UTSW 14 30909476 missense probably benign
Y5408:Itih3 UTSW 14 30921945 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGTCTGAGGTCTACCCCAAGG -3'
(R):5'- AGCTTTTACCCACTTCCACAGG -3'

Sequencing Primer
(F):5'- CCCAAGGGAGAGACACAAAG -3'
(R):5'- TCCACAGGGAATTGGGGGC -3'
Posted On2015-03-25