Incidental Mutation 'R3794:Polr2k'
ID272699
Institutional Source Beutler Lab
Gene Symbol Polr2k
Ensembl Gene ENSMUSG00000045996
Gene Namepolymerase (RNA) II (DNA directed) polypeptide K
SynonymsRPB12, RPB7.0, ABC10-alpha, MafY, RPB10alpha, Mt1a, RPABC4
MMRRC Submission 040756-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.466) question?
Stock #R3794 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location36174010-36177010 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 36175047 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 18 (I18V)
Ref Sequence ENSEMBL: ENSMUSP00000136975 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047348] [ENSMUST00000057177] [ENSMUST00000171205] [ENSMUST00000180159] [ENSMUST00000227623]
Predicted Effect probably benign
Transcript: ENSMUST00000047348
SMART Domains Protein: ENSMUSP00000047335
Gene: ENSMUSG00000037617

DomainStartEndE-ValueType
TPR 213 246 1.88e0 SMART
TPR 247 279 3.47e-4 SMART
TPR 280 313 8.23e-6 SMART
low complexity region 383 400 N/A INTRINSIC
TPR 430 463 5.92e1 SMART
TPR 472 505 2.49e-5 SMART
TPR 506 539 5.31e0 SMART
TPR 606 639 7.63e-1 SMART
TPR 640 673 1.38e-7 SMART
Pfam:RPAP3_C 777 869 1.7e-18 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000057177
AA Change: I59V

PolyPhen 2 Score 0.653 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000051968
Gene: ENSMUSG00000045996
AA Change: I59V

DomainStartEndE-ValueType
RPOLCX 56 99 6.19e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171205
SMART Domains Protein: ENSMUSP00000132233
Gene: ENSMUSG00000037617

DomainStartEndE-ValueType
TPR 213 246 1.88e0 SMART
TPR 247 279 3.47e-4 SMART
TPR 280 313 8.23e-6 SMART
low complexity region 383 400 N/A INTRINSIC
TPR 430 463 5.92e1 SMART
TPR 472 505 2.49e-5 SMART
TPR 506 539 5.31e0 SMART
TPR 606 639 7.63e-1 SMART
TPR 640 673 1.38e-7 SMART
Pfam:RPAP3_C 777 869 1.7e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000180159
AA Change: I18V

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000136975
Gene: ENSMUSG00000045996
AA Change: I18V

DomainStartEndE-ValueType
RPOLCX 15 58 6.19e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000227623
Meta Mutation Damage Score 0.1204 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the smallest subunits of RNA polymerase II, the polymerase responsible for synthesizing messenger RNA in eukaryotes. This subunit is shared by the other two DNA-directed RNA polymerases. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933403O08Rik T G X: 112,240,678 M1R probably null Het
Adcy6 C T 15: 98,598,943 V482I probably damaging Het
Adgrv1 T A 13: 81,283,367 M1L probably damaging Het
Ceacam13 A G 7: 18,013,415 *264W probably null Het
D430042O09Rik A G 7: 125,820,089 N476S probably benign Het
Dennd5b A T 6: 149,101,217 D31E possibly damaging Het
Dip2c T C 13: 9,604,561 V706A probably damaging Het
Enpp3 T C 10: 24,831,732 probably null Het
Exoc4 T G 6: 33,475,997 V474G probably benign Het
F2rl1 A G 13: 95,513,211 Y388H unknown Het
Fasl T C 1: 161,781,737 R17G probably benign Het
Htr1a G A 13: 105,444,344 V31M possibly damaging Het
Inpp4b T C 8: 82,033,216 V445A probably damaging Het
Itih3 T C 14: 30,918,394 Y319C probably damaging Het
Kmt2d T C 15: 98,837,359 probably benign Het
Mobp A T 9: 120,167,967 K55* probably null Het
Ndufaf5 T A 2: 140,202,923 M279K possibly damaging Het
Nlrc3 T C 16: 3,947,875 I1057V probably benign Het
Olfr1217 G T 2: 89,023,426 H192Q probably benign Het
Olfr129 A G 17: 38,054,895 Y224H probably damaging Het
Piezo2 C T 18: 63,081,793 R1257Q probably damaging Het
Pigv A G 4: 133,665,191 S223P possibly damaging Het
Pkdcc A G 17: 83,223,953 T464A probably damaging Het
Pon3 A G 6: 5,221,578 Y351H probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Scaf8 A G 17: 3,190,249 E632G probably damaging Het
Smurf1 A G 5: 144,901,175 probably null Het
Tcrg-V5 A T 13: 19,192,524 H47L probably benign Het
Tln1 G T 4: 43,536,295 A1999D probably damaging Het
Ttn C T 2: 76,942,437 V2405I possibly damaging Het
Vps13d G A 4: 145,085,437 probably benign Het
Xrcc1 A G 7: 24,570,560 T469A probably benign Het
Zfp287 G T 11: 62,714,244 H612Q probably damaging Het
Zfp352 C T 4: 90,225,149 H509Y probably damaging Het
Other mutations in Polr2k
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03128:Polr2k APN 15 36174191 missense probably damaging 0.98
R0415:Polr2k UTSW 15 36175456 missense probably damaging 1.00
R3795:Polr2k UTSW 15 36175047 missense probably damaging 0.97
R5213:Polr2k UTSW 15 36174997 start codon destroyed probably null 0.82
R6986:Polr2k UTSW 15 36175035 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- TTATTCTTAAGACCCAGCCCAC -3'
(R):5'- AAGGGCTGTAGGCAGTACAC -3'

Sequencing Primer
(F):5'- TCTGCATGCTAGGCAAACATTC -3'
(R):5'- GTAGGCAGTACACCTTTTCCAG -3'
Posted On2015-03-25