Mutagenetix > Incidental Mutations

Incidental Mutation 'R3794:Nlrc3'

272703

Institutional Source

Beutler Lab

Gene Symbol

Nlrc3

Ensembl Gene

ENSMUSG00000049871

Gene Name

NLR family, CARD domain containing 3

Synonyms

CLR16.2, Caterpiller 16.2, D230007K08Rik

MMRRC Submission

040756-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.114) question?

Stock #

R3794 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

3945007-3976632 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 3947875 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 1057 (I1057V)

Ref Sequence

ENSEMBL: ENSMUSP00000137628 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000177551] [ENSMUST00000180200] [ENSMUST00000229884]

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000096308

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000163478

Predicted Effect

probably benign
Transcript: ENSMUST00000177551
AA Change: I1057V

PolyPhen 2 Score 0.216 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000137628
Gene: ENSMUSG00000049871
AA Change: I1057V

Domain	Start	End	E-Value	Type
Pfam:NACHT	176	342	2e-34	PFAM
LRR	702	729	3.11e-2	SMART
LRR	730	757	2.27e-4	SMART
LRR	758	785	8.15e-1	SMART
LRR	786	813	2.17e-1	SMART
LRR	814	841	2.12e-4	SMART
LRR	842	869	3.42e0	SMART
LRR	870	897	7.67e-2	SMART
LRR	898	925	3.21e0	SMART
LRR	926	953	1.67e0	SMART
LRR	954	981	4.87e-4	SMART
LRR	982	1009	4.3e0	SMART
LRR	1010	1037	3.8e-6	SMART
LRR	1038	1065	4.47e-3	SMART
LRR	1066	1093	1.08e-1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000180200
AA Change: I352V

PolyPhen 2 Score 0.107 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000137325
Gene: ENSMUSG00000049871
AA Change: I352V

Domain	Start	End	E-Value	Type
LRR	4	24	8.65e1	SMART
LRR	25	52	2.27e-4	SMART
LRR	53	80	8.15e-1	SMART
LRR	81	108	2.17e-1	SMART
LRR	109	136	2.12e-4	SMART
LRR	137	164	3.42e0	SMART
LRR	165	192	7.67e-2	SMART
LRR	193	220	3.21e0	SMART
LRR	221	248	1.67e0	SMART
LRR	249	276	4.87e-4	SMART
LRR	277	304	4.3e0	SMART
LRR	305	332	3.8e-6	SMART
LRR	333	360	4.47e-3	SMART
LRR	361	388	1.08e-1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000229884
AA Change: I929V

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)

Meta Mutation Damage Score

0.1023

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.4%

Validation Efficiency

97% (37/38)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a NOD-like receptor family member. The encoded protein is a cytosolic regulator of innate immunity. This protein directly interacts with stimulator of interferon genes (STING), to prevent its proper trafficking, resulting in disruption of STING-dependent activation of the innate immune response. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit enhanced susceptibility to LPS-induced toxic shock. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933403O08Rik	T	G	X: 112,240,678	M1R	probably null	Het
Adcy6	C	T	15: 98,598,943	V482I	probably damaging	Het
Adgrv1	T	A	13: 81,283,367	M1L	probably damaging	Het
Ceacam13	A	G	7: 18,013,415	*264W	probably null	Het
D430042O09Rik	A	G	7: 125,820,089	N476S	probably benign	Het
Dennd5b	A	T	6: 149,101,217	D31E	possibly damaging	Het
Dip2c	T	C	13: 9,604,561	V706A	probably damaging	Het
Enpp3	T	C	10: 24,831,732		probably null	Het
Exoc4	T	G	6: 33,475,997	V474G	probably benign	Het
F2rl1	A	G	13: 95,513,211	Y388H	unknown	Het
Fasl	T	C	1: 161,781,737	R17G	probably benign	Het
Htr1a	G	A	13: 105,444,344	V31M	possibly damaging	Het
Inpp4b	T	C	8: 82,033,216	V445A	probably damaging	Het
Itih3	T	C	14: 30,918,394	Y319C	probably damaging	Het
Kmt2d	T	C	15: 98,837,359		probably benign	Het
Mobp	A	T	9: 120,167,967	K55*	probably null	Het
Ndufaf5	T	A	2: 140,202,923	M279K	possibly damaging	Het
Olfr1217	G	T	2: 89,023,426	H192Q	probably benign	Het
Olfr129	A	G	17: 38,054,895	Y224H	probably damaging	Het
Piezo2	C	T	18: 63,081,793	R1257Q	probably damaging	Het
Pigv	A	G	4: 133,665,191	S223P	possibly damaging	Het
Pkdcc	A	G	17: 83,223,953	T464A	probably damaging	Het
Polr2k	A	G	15: 36,175,047	I18V	probably damaging	Het
Pon3	A	G	6: 5,221,578	Y351H	probably benign	Het
Rsf1	ATGGCG	ATGGCGACGGTGGCG	7: 97,579,904		probably benign	Het
Scaf8	A	G	17: 3,190,249	E632G	probably damaging	Het
Smurf1	A	G	5: 144,901,175		probably null	Het
Tcrg-V5	A	T	13: 19,192,524	H47L	probably benign	Het
Tln1	G	T	4: 43,536,295	A1999D	probably damaging	Het
Ttn	C	T	2: 76,942,437	V2405I	possibly damaging	Het
Vps13d	G	A	4: 145,085,437		probably benign	Het
Xrcc1	A	G	7: 24,570,560	T469A	probably benign	Het
Zfp287	G	T	11: 62,714,244	H612Q	probably damaging	Het
Zfp352	C	T	4: 90,225,149	H509Y	probably damaging	Het

Other mutations in Nlrc3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00327:Nlrc3	APN	16	3955166	missense	probably damaging	1.00
IGL00943:Nlrc3	APN	16	3965117	missense	possibly damaging	0.94
IGL01481:Nlrc3	APN	16	3963905	missense	probably damaging	1.00
IGL01517:Nlrc3	APN	16	3947487	missense	probably damaging	0.99
IGL01988:Nlrc3	APN	16	3953939	missense	probably benign	0.43
IGL02306:Nlrc3	APN	16	3964824	missense	probably damaging	1.00
IGL02515:Nlrc3	APN	16	3949459	splice site	probably benign
IGL02795:Nlrc3	APN	16	3965285	missense	probably damaging	0.99
IGL02897:Nlrc3	APN	16	3964074	missense	possibly damaging	0.85
IGL02992:Nlrc3	APN	16	3954023	splice site	probably benign
IGL03003:Nlrc3	APN	16	3964862	missense	probably benign	0.03
IGL03381:Nlrc3	APN	16	3964315	missense	probably benign	0.03
R0064:Nlrc3	UTSW	16	3964087	missense	possibly damaging	0.82
R0064:Nlrc3	UTSW	16	3964087	missense	possibly damaging	0.82
R0122:Nlrc3	UTSW	16	3958958	missense	probably damaging	0.98
R0482:Nlrc3	UTSW	16	3965192	missense	possibly damaging	0.81
R0601:Nlrc3	UTSW	16	3948249	splice site	probably benign
R0622:Nlrc3	UTSW	16	3953968	missense	probably benign	0.04
R0675:Nlrc3	UTSW	16	3948911	missense	probably benign	0.01
R1595:Nlrc3	UTSW	16	3965302	missense	probably benign	0.03
R1597:Nlrc3	UTSW	16	3963995	missense	probably damaging	1.00
R2013:Nlrc3	UTSW	16	3965110	missense	probably damaging	1.00
R2077:Nlrc3	UTSW	16	3963992	missense	probably benign	0.35
R2327:Nlrc3	UTSW	16	3953440	missense	probably damaging	1.00
R2872:Nlrc3	UTSW	16	3957326	missense	possibly damaging	0.56
R2872:Nlrc3	UTSW	16	3957326	missense	possibly damaging	0.56
R3037:Nlrc3	UTSW	16	3952408	missense	probably damaging	1.00
R3843:Nlrc3	UTSW	16	3964964	missense	probably benign
R4761:Nlrc3	UTSW	16	3963650	missense	probably damaging	1.00
R5303:Nlrc3	UTSW	16	3963614	missense	probably benign	0.15
R5375:Nlrc3	UTSW	16	3964753	missense	possibly damaging	0.95
R5468:Nlrc3	UTSW	16	3964035	missense	probably damaging	1.00
R5719:Nlrc3	UTSW	16	3963725	missense	probably damaging	1.00
R5838:Nlrc3	UTSW	16	3953995	missense	probably damaging	1.00
R5879:Nlrc3	UTSW	16	3964045	missense	probably damaging	1.00
R5942:Nlrc3	UTSW	16	3949429	missense	probably damaging	1.00
R6500:Nlrc3	UTSW	16	3952444	missense	possibly damaging	0.79
R6600:Nlrc3	UTSW	16	3965074	missense	probably benign	0.29
R6704:Nlrc3	UTSW	16	3965081	missense	probably damaging	0.99
R7172:Nlrc3	UTSW	16	3963753	missense	probably benign	0.30
R7283:Nlrc3	UTSW	16	3947877	missense	probably benign	0.25
R7296:Nlrc3	UTSW	16	3963590	missense	probably damaging	0.99
R7477:Nlrc3	UTSW	16	3964811	missense	probably damaging	0.99
R7817:Nlrc3	UTSW	16	3965463	missense	possibly damaging	0.87
R8118:Nlrc3	UTSW	16	3965631	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AGGACCCTACTGAATTTGCCC -3'
(R):5'- AGAGGTCAAATGTCAGTCTAGC -3'

Sequencing Primer
(F):5'- TAGACCTAGTCTCCCCGTGG -3'
(R):5'- GTCAAATGTCAGTCTAGCAGTTGC -3'

Posted On

2015-03-25