Incidental Mutation 'R3795:Wdr47'
ID272715
Institutional Source Beutler Lab
Gene Symbol Wdr47
Ensembl Gene ENSMUSG00000040389
Gene NameWD repeat domain 47
Synonyms1810073M12Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3795 (G1)
Quality Score211
Status Validated
Chromosome3
Chromosomal Location108591279-108645719 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 108624737 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000057482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051145]
Predicted Effect probably null
Transcript: ENSMUST00000051145
SMART Domains Protein: ENSMUSP00000057482
Gene: ENSMUSG00000040389

DomainStartEndE-ValueType
LisH 10 42 8.87e-4 SMART
CTLH 45 102 1.93e-13 SMART
low complexity region 137 146 N/A INTRINSIC
low complexity region 226 254 N/A INTRINSIC
coiled coil region 414 455 N/A INTRINSIC
low complexity region 506 523 N/A INTRINSIC
WD40 597 635 7e-4 SMART
WD40 648 690 5.18e-7 SMART
WD40 698 742 2.28e2 SMART
WD40 745 783 9.38e-5 SMART
WD40 790 829 1.31e-3 SMART
WD40 832 871 1.28e-6 SMART
WD40 878 917 7.39e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123568
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133453
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144325
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197398
Meta Mutation Damage Score 0.9491 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 97% (32/33)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 37,030,565 T426A probably benign Het
9130204L05Rik T C 3: 91,088,423 I57M possibly damaging Het
Abcb9 T C 5: 124,090,149 T10A probably benign Het
Adh1 T A 3: 138,279,765 L18H possibly damaging Het
Capn13 C A 17: 73,337,392 V381L probably benign Het
Cfap54 T C 10: 92,942,873 probably benign Het
Cmas T A 6: 142,767,868 D206E probably benign Het
Cntnap1 A G 11: 101,186,764 E1084G probably damaging Het
Cpz A G 5: 35,511,749 V346A probably benign Het
D430042O09Rik A G 7: 125,820,089 N476S probably benign Het
Dhrs3 A G 4: 144,919,392 D116G probably damaging Het
Gm11639 A G 11: 104,733,675 E844G possibly damaging Het
Inpp4b T C 8: 82,033,216 V445A probably damaging Het
Lhx2 T C 2: 38,353,347 C12R probably damaging Het
Map3k2 T C 18: 32,226,648 M518T probably benign Het
Mrc1 T A 2: 14,288,982 probably benign Het
Nlrp4e T A 7: 23,320,803 D238E probably benign Het
Obscn A G 11: 59,031,841 Y6543H probably damaging Het
Pigv A G 4: 133,665,191 S223P possibly damaging Het
Pkdcc A G 17: 83,223,953 T464A probably damaging Het
Polr2k A G 15: 36,175,047 I18V probably damaging Het
Psg20 A G 7: 18,684,449 V131A probably benign Het
Ptpro T C 6: 137,380,309 F266S probably benign Het
Sdk2 G A 11: 113,856,696 R663* probably null Het
Szt2 G T 4: 118,391,730 L586I probably damaging Het
Tln2 T C 9: 67,255,915 I1113V probably damaging Het
Ube2ql1 G T 13: 69,704,112 A282E possibly damaging Het
Vmn2r50 T A 7: 10,037,924 M617L probably benign Het
Wdfy3 A G 5: 101,937,600 V676A probably damaging Het
Zbp1 T C 2: 173,212,179 H183R probably benign Het
Zfp352 C T 4: 90,225,149 H509Y probably damaging Het
Zfp988 G A 4: 147,331,583 R158Q possibly damaging Het
Other mutations in Wdr47
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00576:Wdr47 APN 3 108618734 missense probably benign 0.04
IGL01730:Wdr47 APN 3 108611396 missense probably damaging 1.00
IGL01821:Wdr47 APN 3 108627204 missense probably damaging 1.00
IGL03367:Wdr47 APN 3 108629773 splice site probably benign
R0025:Wdr47 UTSW 3 108637991 missense probably damaging 1.00
R0217:Wdr47 UTSW 3 108637020 missense probably damaging 0.96
R0733:Wdr47 UTSW 3 108618623 missense probably damaging 1.00
R1329:Wdr47 UTSW 3 108627299 missense probably benign 0.14
R1330:Wdr47 UTSW 3 108629753 missense probably benign 0.30
R1894:Wdr47 UTSW 3 108623376 missense possibly damaging 0.56
R2004:Wdr47 UTSW 3 108627442 nonsense probably null
R2040:Wdr47 UTSW 3 108623372 missense probably benign 0.01
R2242:Wdr47 UTSW 3 108619115 missense probably damaging 1.00
R5026:Wdr47 UTSW 3 108618522 nonsense probably null
R5732:Wdr47 UTSW 3 108633156 nonsense probably null
R5823:Wdr47 UTSW 3 108643085 missense probably damaging 1.00
R5838:Wdr47 UTSW 3 108624736 critical splice donor site probably null
R5890:Wdr47 UTSW 3 108610012 missense probably damaging 1.00
R5896:Wdr47 UTSW 3 108619006 missense probably damaging 1.00
R5898:Wdr47 UTSW 3 108637885 splice site probably null
R6778:Wdr47 UTSW 3 108633096 missense probably benign 0.16
R7019:Wdr47 UTSW 3 108614355 nonsense probably null
R7051:Wdr47 UTSW 3 108618524 missense probably damaging 1.00
R7535:Wdr47 UTSW 3 108629711 missense probably benign 0.01
R7642:Wdr47 UTSW 3 108643164 missense possibly damaging 0.47
R7709:Wdr47 UTSW 3 108618521 missense probably damaging 1.00
R8048:Wdr47 UTSW 3 108618968 missense probably damaging 0.99
X0062:Wdr47 UTSW 3 108619058 missense probably benign 0.01
Z1177:Wdr47 UTSW 3 108619114 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTTCGAGATTCCACTGAAC -3'
(R):5'- TGAGCTGAACCACCACACTG -3'

Sequencing Primer
(F):5'- GCTTCGAGATTCCACTGAACAATTTC -3'
(R):5'- TACTTGATGCTCAAAGAGGCC -3'
Posted On2015-03-25