Incidental Mutation 'R3795:Psg20'
ID272728
Institutional Source Beutler Lab
Gene Symbol Psg20
Ensembl Gene ENSMUSG00000063305
Gene Namepregnancy-specific glycoprotein 20
Synonymscea7, EG434540
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R3795 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location18674107-18686185 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 18684449 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 131 (V131A)
Ref Sequence ENSEMBL: ENSMUSP00000075973 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076677] [ENSMUST00000108482]
Predicted Effect probably benign
Transcript: ENSMUST00000076677
AA Change: V131A

PolyPhen 2 Score 0.087 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000075973
Gene: ENSMUSG00000063305
AA Change: V131A

DomainStartEndE-ValueType
IG 40 141 2.34e-4 SMART
IG 160 261 2.14e0 SMART
IG 280 381 8.01e-3 SMART
IGc2 397 461 1.47e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108482
AA Change: V131A

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000104122
Gene: ENSMUSG00000063305
AA Change: V131A

DomainStartEndE-ValueType
IG 40 141 2.34e-4 SMART
IG 160 261 2.14e0 SMART
IG 277 378 8.01e-3 SMART
IGc2 394 458 1.47e-10 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 97% (32/33)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 37,030,565 T426A probably benign Het
9130204L05Rik T C 3: 91,088,423 I57M possibly damaging Het
Abcb9 T C 5: 124,090,149 T10A probably benign Het
Adh1 T A 3: 138,279,765 L18H possibly damaging Het
Capn13 C A 17: 73,337,392 V381L probably benign Het
Cfap54 T C 10: 92,942,873 probably benign Het
Cmas T A 6: 142,767,868 D206E probably benign Het
Cntnap1 A G 11: 101,186,764 E1084G probably damaging Het
Cpz A G 5: 35,511,749 V346A probably benign Het
D430042O09Rik A G 7: 125,820,089 N476S probably benign Het
Dhrs3 A G 4: 144,919,392 D116G probably damaging Het
Gm11639 A G 11: 104,733,675 E844G possibly damaging Het
Inpp4b T C 8: 82,033,216 V445A probably damaging Het
Lhx2 T C 2: 38,353,347 C12R probably damaging Het
Map3k2 T C 18: 32,226,648 M518T probably benign Het
Mrc1 T A 2: 14,288,982 probably benign Het
Nlrp4e T A 7: 23,320,803 D238E probably benign Het
Obscn A G 11: 59,031,841 Y6543H probably damaging Het
Pigv A G 4: 133,665,191 S223P possibly damaging Het
Pkdcc A G 17: 83,223,953 T464A probably damaging Het
Polr2k A G 15: 36,175,047 I18V probably damaging Het
Ptpro T C 6: 137,380,309 F266S probably benign Het
Sdk2 G A 11: 113,856,696 R663* probably null Het
Szt2 G T 4: 118,391,730 L586I probably damaging Het
Tln2 T C 9: 67,255,915 I1113V probably damaging Het
Ube2ql1 G T 13: 69,704,112 A282E possibly damaging Het
Vmn2r50 T A 7: 10,037,924 M617L probably benign Het
Wdfy3 A G 5: 101,937,600 V676A probably damaging Het
Wdr47 T C 3: 108,624,737 probably null Het
Zbp1 T C 2: 173,212,179 H183R probably benign Het
Zfp352 C T 4: 90,225,149 H509Y probably damaging Het
Zfp988 G A 4: 147,331,583 R158Q possibly damaging Het
Other mutations in Psg20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Psg20 APN 7 18674611 missense possibly damaging 0.72
IGL01459:Psg20 APN 7 18682713 missense probably damaging 1.00
IGL01599:Psg20 APN 7 18681038 missense possibly damaging 0.83
IGL01678:Psg20 APN 7 18680870 missense probably damaging 1.00
IGL01991:Psg20 APN 7 18684425 missense probably benign 0.01
IGL02449:Psg20 APN 7 18684408 splice site probably benign
IGL02522:Psg20 APN 7 18682431 missense probably benign 0.06
IGL03358:Psg20 APN 7 18680966 missense probably benign 0.04
PIT4431001:Psg20 UTSW 7 18674550 missense probably damaging 1.00
R0136:Psg20 UTSW 7 18682507 missense probably damaging 0.98
R0184:Psg20 UTSW 7 18685976 missense probably null 0.95
R0894:Psg20 UTSW 7 18681044 nonsense probably null
R1291:Psg20 UTSW 7 18684674 missense possibly damaging 0.46
R1997:Psg20 UTSW 7 18682610 missense probably benign 0.00
R2118:Psg20 UTSW 7 18681022 missense probably benign 0.19
R2119:Psg20 UTSW 7 18681022 missense probably benign 0.19
R2120:Psg20 UTSW 7 18681022 missense probably benign 0.19
R2121:Psg20 UTSW 7 18681022 missense probably benign 0.19
R2124:Psg20 UTSW 7 18681022 missense probably benign 0.19
R2127:Psg20 UTSW 7 18682718 missense probably damaging 0.99
R4115:Psg20 UTSW 7 18685980 missense probably damaging 1.00
R4238:Psg20 UTSW 7 18684509 missense probably damaging 1.00
R5004:Psg20 UTSW 7 18680912 missense probably damaging 1.00
R5025:Psg20 UTSW 7 18674366 makesense probably null
R6294:Psg20 UTSW 7 18682679 missense probably damaging 1.00
R6733:Psg20 UTSW 7 18674622 missense probably damaging 0.99
R6744:Psg20 UTSW 7 18674580 missense probably damaging 1.00
R6799:Psg20 UTSW 7 18684420 missense probably benign 0.06
R7466:Psg20 UTSW 7 18684467 missense probably benign 0.00
R7524:Psg20 UTSW 7 18684659 missense probably benign 0.18
R7583:Psg20 UTSW 7 18682483 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATTGTTCTCCACCATGTGTG -3'
(R):5'- CGAGTTGACAATCTGCCAGAG -3'

Sequencing Primer
(F):5'- CCACCATGTGTGTCCTGC -3'
(R):5'- GACAATCTGCCAGAGGATCTTCTAG -3'
Posted On2015-03-25