Incidental Mutation 'R3796:Trpa1'
ID272746
Institutional Source Beutler Lab
Gene Symbol Trpa1
Ensembl Gene ENSMUSG00000032769
Gene Nametransient receptor potential cation channel, subfamily A, member 1
SynonymsANKTM1
MMRRC Submission 040757-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.138) question?
Stock #R3796 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location14872648-14918862 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 14893264 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 578 (N578S)
Ref Sequence ENSEMBL: ENSMUSP00000043594 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041447]
Predicted Effect possibly damaging
Transcript: ENSMUST00000041447
AA Change: N578S

PolyPhen 2 Score 0.736 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000043594
Gene: ENSMUSG00000032769
AA Change: N578S

DomainStartEndE-ValueType
ANK 63 94 1.01e2 SMART
ANK 98 127 9.7e-8 SMART
ANK 131 161 1.36e-2 SMART
ANK 165 194 5.45e-2 SMART
ANK 198 226 3.07e2 SMART
ANK 239 268 1.99e-4 SMART
ANK 272 302 1.33e2 SMART
ANK 309 338 4.19e-3 SMART
ANK 342 371 2.34e-1 SMART
ANK 413 442 3.41e-3 SMART
ANK 446 475 5.75e-1 SMART
ANK 482 511 4.1e-6 SMART
ANK 514 543 1.68e-2 SMART
ANK 548 577 4.97e-5 SMART
Blast:ANK 580 609 2e-11 BLAST
Pfam:Ion_trans 736 975 1.8e-11 PFAM
Meta Mutation Damage Score 0.6641 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The structure of the protein encoded by this gene is highly related to both the protein ankyrin and transmembrane proteins. The specific function of this protein has not yet been determined; however, studies indicate the function may involve a role in signal transduction and growth control. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene result in altered nociception and neuron responses to isothiocyanate or thiosulfinate compounds like those found in mustard oil and garlic. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130011E15Rik A G 19: 45,921,610 probably benign Het
Adamts17 A G 7: 66,839,914 probably null Het
Alpk3 C A 7: 81,092,753 P773T probably benign Het
Alppl2 A G 1: 87,088,354 probably null Het
Basp1 C A 15: 25,364,312 probably benign Het
Clec14a G A 12: 58,267,909 A309V probably benign Het
Clk2 A G 3: 89,175,689 N424S probably benign Het
Cops7a C T 6: 124,959,832 R252H probably damaging Het
Csmd2 C T 4: 128,517,595 P2469S probably benign Het
Cwf19l1 A G 19: 44,114,567 V403A probably damaging Het
Dnajc16 G T 4: 141,767,737 D521E probably benign Het
Dnm2 T C 9: 21,505,487 V772A probably benign Het
Dst G T 1: 34,181,915 V2267F probably benign Het
Eif3d A G 15: 77,968,569 F4S probably damaging Het
Fgfr1 G A 8: 25,572,437 D663N probably damaging Het
Hmcn1 A G 1: 150,586,418 Y5170H probably damaging Het
Kcna2 T A 3: 107,105,590 L496I probably benign Het
Krt8 T C 15: 101,999,442 I233V probably benign Het
Mfap1b A G 2: 121,473,905 V3A probably benign Het
Phrf1 C T 7: 141,259,918 R243* probably null Het
Plbd2 A T 5: 120,492,868 I224N probably damaging Het
Rab19 T C 6: 39,384,041 V41A probably benign Het
Rrm1 T A 7: 102,465,703 probably null Het
Sacs T C 14: 61,206,121 V1872A possibly damaging Het
Setd2 T C 9: 110,549,571 V818A probably benign Het
Shprh C T 10: 11,178,757 L1037F possibly damaging Het
Slc24a3 A G 2: 145,616,681 D527G probably damaging Het
Slc27a6 T C 18: 58,598,751 probably benign Het
Slc35g3 A G 11: 69,760,917 F103L probably benign Het
Slc5a1 A G 5: 33,152,652 D408G probably damaging Het
Spag6l A T 16: 16,763,052 I477N probably damaging Het
Srgap1 A G 10: 122,047,132 V21A probably benign Het
Trim7 A G 11: 48,845,670 probably null Het
Xdh T C 17: 73,907,658 E764G probably damaging Het
Zfp518a G T 19: 40,915,310 V1228F probably damaging Het
Other mutations in Trpa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00801:Trpa1 APN 1 14891333 missense probably damaging 0.97
IGL00937:Trpa1 APN 1 14880277 splice site probably benign
IGL00957:Trpa1 APN 1 14881668 missense probably damaging 0.99
IGL01307:Trpa1 APN 1 14896547 missense probably benign 0.23
IGL01336:Trpa1 APN 1 14886880 splice site probably benign
IGL01408:Trpa1 APN 1 14889413 missense probably benign 0.03
IGL01504:Trpa1 APN 1 14882219 missense possibly damaging 0.79
IGL01543:Trpa1 APN 1 14900076 missense probably damaging 1.00
IGL01609:Trpa1 APN 1 14912383 missense probably damaging 0.99
IGL01895:Trpa1 APN 1 14887643 missense possibly damaging 0.87
IGL02449:Trpa1 APN 1 14898157 missense probably damaging 1.00
IGL02936:Trpa1 APN 1 14875969 splice site probably null
fear-2 UTSW 1 14891303 critical splice donor site probably null
petrified UTSW 1 14884116 missense probably damaging 1.00
R0008:Trpa1 UTSW 1 14903215 missense possibly damaging 0.53
R0008:Trpa1 UTSW 1 14903215 missense possibly damaging 0.53
R0317:Trpa1 UTSW 1 14881632 missense probably benign 0.03
R0454:Trpa1 UTSW 1 14885748 critical splice donor site probably null
R0828:Trpa1 UTSW 1 14875884 missense probably damaging 1.00
R0944:Trpa1 UTSW 1 14912361 splice site probably null
R0962:Trpa1 UTSW 1 14898163 missense possibly damaging 0.61
R1025:Trpa1 UTSW 1 14904183 missense probably benign 0.01
R1035:Trpa1 UTSW 1 14891303 critical splice donor site probably null
R1134:Trpa1 UTSW 1 14881748 missense possibly damaging 0.95
R1278:Trpa1 UTSW 1 14918723 critical splice donor site probably null
R1497:Trpa1 UTSW 1 14885812 missense probably benign 0.30
R1617:Trpa1 UTSW 1 14873675 missense probably damaging 1.00
R1800:Trpa1 UTSW 1 14874424 missense probably benign 0.04
R1856:Trpa1 UTSW 1 14899388 nonsense probably null
R1886:Trpa1 UTSW 1 14889425 missense probably benign 0.00
R2004:Trpa1 UTSW 1 14905983 missense possibly damaging 0.83
R2152:Trpa1 UTSW 1 14899401 missense probably damaging 1.00
R2172:Trpa1 UTSW 1 14881656 missense probably benign 0.01
R2198:Trpa1 UTSW 1 14910746 missense probably benign
R2221:Trpa1 UTSW 1 14903256 missense probably null 0.12
R2223:Trpa1 UTSW 1 14903256 missense probably null 0.12
R2307:Trpa1 UTSW 1 14912381 missense probably benign 0.00
R2338:Trpa1 UTSW 1 14884245 missense probably damaging 0.97
R2698:Trpa1 UTSW 1 14905998 missense probably damaging 1.00
R2872:Trpa1 UTSW 1 14887620 missense probably damaging 1.00
R2872:Trpa1 UTSW 1 14887620 missense probably damaging 1.00
R2873:Trpa1 UTSW 1 14887620 missense probably damaging 1.00
R2874:Trpa1 UTSW 1 14887620 missense probably damaging 1.00
R3418:Trpa1 UTSW 1 14874381 missense probably benign 0.01
R3419:Trpa1 UTSW 1 14874381 missense probably benign 0.01
R3799:Trpa1 UTSW 1 14893264 missense possibly damaging 0.74
R4238:Trpa1 UTSW 1 14884116 missense probably damaging 1.00
R4320:Trpa1 UTSW 1 14874452 missense probably benign 0.00
R4591:Trpa1 UTSW 1 14882108 splice site probably null
R4834:Trpa1 UTSW 1 14896523 missense possibly damaging 0.72
R4991:Trpa1 UTSW 1 14910746 missense probably benign 0.00
R4999:Trpa1 UTSW 1 14875861 missense probably benign 0.05
R5038:Trpa1 UTSW 1 14910866 missense probably damaging 1.00
R5055:Trpa1 UTSW 1 14875959 missense probably damaging 1.00
R5158:Trpa1 UTSW 1 14881661 missense probably benign 0.01
R5193:Trpa1 UTSW 1 14875917 missense possibly damaging 0.92
R5558:Trpa1 UTSW 1 14898268 missense probably damaging 1.00
R5578:Trpa1 UTSW 1 14887008 missense probably damaging 1.00
R5680:Trpa1 UTSW 1 14875854 missense probably benign 0.00
R5738:Trpa1 UTSW 1 14875950 missense probably damaging 1.00
R5801:Trpa1 UTSW 1 14898078 missense probably damaging 1.00
R5945:Trpa1 UTSW 1 14898135 missense probably benign 0.03
R6092:Trpa1 UTSW 1 14889486 missense probably damaging 1.00
R6776:Trpa1 UTSW 1 14912377 missense probably benign
R7126:Trpa1 UTSW 1 14890424 missense probably benign 0.00
R7154:Trpa1 UTSW 1 14882233 missense possibly damaging 0.46
R7175:Trpa1 UTSW 1 14893207 missense possibly damaging 0.90
R7258:Trpa1 UTSW 1 14903249 missense probably damaging 1.00
R7358:Trpa1 UTSW 1 14898110 missense probably damaging 1.00
R7412:Trpa1 UTSW 1 14884198 missense probably benign 0.43
R7639:Trpa1 UTSW 1 14886913 missense probably benign 0.00
R7740:Trpa1 UTSW 1 14912401 missense possibly damaging 0.72
R7815:Trpa1 UTSW 1 14904262 missense probably benign 0.01
R7854:Trpa1 UTSW 1 14881694 missense probably benign 0.00
R8112:Trpa1 UTSW 1 14904266 missense probably benign
R8217:Trpa1 UTSW 1 14887023 missense probably damaging 0.97
X0028:Trpa1 UTSW 1 14890420 missense probably benign 0.16
Z1176:Trpa1 UTSW 1 14881692 missense probably damaging 1.00
Z1176:Trpa1 UTSW 1 14891306 missense possibly damaging 0.80
Z1176:Trpa1 UTSW 1 14898350 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGCAGGCATTTGTGTAATG -3'
(R):5'- CCATGTGAAGGCATCTTGTCC -3'

Sequencing Primer
(F):5'- CAGATATAAAGCTGAGGCATGTCC -3'
(R):5'- ACACAGCACTCCACTTTG -3'
Posted On2015-03-25