Incidental Mutation 'R3796:Alppl2'
ID272747
Institutional Source Beutler Lab
Gene Symbol Alppl2
Ensembl Gene ENSMUSG00000026246
Gene Namealkaline phosphatase, placental-like 2
SynonymsAkp5, D1Ertd816e
MMRRC Submission 040757-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock #R3796 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location87086694-87089928 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 87088354 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000139887 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027455] [ENSMUST00000027455] [ENSMUST00000188310] [ENSMUST00000188310]
Predicted Effect probably null
Transcript: ENSMUST00000027455
SMART Domains Protein: ENSMUSP00000027455
Gene: ENSMUSG00000026246

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 33 45 N/A INTRINSIC
alkPPc 52 487 2.24e-250 SMART
low complexity region 512 527 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000027455
SMART Domains Protein: ENSMUSP00000027455
Gene: ENSMUSG00000026246

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 33 45 N/A INTRINSIC
alkPPc 52 487 2.24e-250 SMART
low complexity region 512 527 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186823
Predicted Effect probably null
Transcript: ENSMUST00000188310
SMART Domains Protein: ENSMUSP00000139887
Gene: ENSMUSG00000026246

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 33 45 N/A INTRINSIC
alkPPc 52 487 2.24e-250 SMART
low complexity region 512 527 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000188310
SMART Domains Protein: ENSMUSP00000139887
Gene: ENSMUSG00000026246

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 33 45 N/A INTRINSIC
alkPPc 52 487 2.24e-250 SMART
low complexity region 512 527 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190082
Meta Mutation Damage Score 0.9377 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] There are at least four distinct but related alkaline phosphatases: intestinal, placental, placental-like, and liver/bone/kidney (tissue non-specific). The product of this gene is a membrane bound glycosylated enzyme, localized to testis, thymus and certain germ cell tumors, that is closely related to both the placental and intestinal forms of alkaline phosphatase. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit strain background-dependent differences in the timing of preimplantation cleavage and development, embryo survival, gestational length and litter size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130011E15Rik A G 19: 45,921,610 probably benign Het
Adamts17 A G 7: 66,839,914 probably null Het
Alpk3 C A 7: 81,092,753 P773T probably benign Het
Basp1 C A 15: 25,364,312 probably benign Het
Clec14a G A 12: 58,267,909 A309V probably benign Het
Clk2 A G 3: 89,175,689 N424S probably benign Het
Cops7a C T 6: 124,959,832 R252H probably damaging Het
Csmd2 C T 4: 128,517,595 P2469S probably benign Het
Cwf19l1 A G 19: 44,114,567 V403A probably damaging Het
Dnajc16 G T 4: 141,767,737 D521E probably benign Het
Dnm2 T C 9: 21,505,487 V772A probably benign Het
Dst G T 1: 34,181,915 V2267F probably benign Het
Eif3d A G 15: 77,968,569 F4S probably damaging Het
Fgfr1 G A 8: 25,572,437 D663N probably damaging Het
Hmcn1 A G 1: 150,586,418 Y5170H probably damaging Het
Kcna2 T A 3: 107,105,590 L496I probably benign Het
Krt8 T C 15: 101,999,442 I233V probably benign Het
Mfap1b A G 2: 121,473,905 V3A probably benign Het
Phrf1 C T 7: 141,259,918 R243* probably null Het
Plbd2 A T 5: 120,492,868 I224N probably damaging Het
Rab19 T C 6: 39,384,041 V41A probably benign Het
Rrm1 T A 7: 102,465,703 probably null Het
Sacs T C 14: 61,206,121 V1872A possibly damaging Het
Setd2 T C 9: 110,549,571 V818A probably benign Het
Shprh C T 10: 11,178,757 L1037F possibly damaging Het
Slc24a3 A G 2: 145,616,681 D527G probably damaging Het
Slc27a6 T C 18: 58,598,751 probably benign Het
Slc35g3 A G 11: 69,760,917 F103L probably benign Het
Slc5a1 A G 5: 33,152,652 D408G probably damaging Het
Spag6l A T 16: 16,763,052 I477N probably damaging Het
Srgap1 A G 10: 122,047,132 V21A probably benign Het
Trim7 A G 11: 48,845,670 probably null Het
Trpa1 T C 1: 14,893,264 N578S possibly damaging Het
Xdh T C 17: 73,907,658 E764G probably damaging Het
Zfp518a G T 19: 40,915,310 V1228F probably damaging Het
Other mutations in Alppl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00984:Alppl2 APN 1 87088812 missense probably damaging 1.00
IGL02404:Alppl2 APN 1 87088863 missense possibly damaging 0.79
I2288:Alppl2 UTSW 1 87088176 missense possibly damaging 0.86
R0194:Alppl2 UTSW 1 87088743 missense probably damaging 1.00
R0305:Alppl2 UTSW 1 87089602 missense probably benign 0.28
R0631:Alppl2 UTSW 1 87089373 missense probably damaging 1.00
R0964:Alppl2 UTSW 1 87087724 missense possibly damaging 0.73
R1976:Alppl2 UTSW 1 87088741 missense probably damaging 1.00
R2140:Alppl2 UTSW 1 87087697 missense probably benign 0.21
R4672:Alppl2 UTSW 1 87089465 intron probably benign
R5020:Alppl2 UTSW 1 87089709 missense probably benign
R5513:Alppl2 UTSW 1 87087338 missense probably benign 0.02
R6258:Alppl2 UTSW 1 87088462 missense probably damaging 1.00
R6260:Alppl2 UTSW 1 87088462 missense probably damaging 1.00
R7026:Alppl2 UTSW 1 87089698 critical splice donor site probably null
R7038:Alppl2 UTSW 1 87089111 missense probably damaging 1.00
R7322:Alppl2 UTSW 1 87087462 missense probably benign 0.26
R7573:Alppl2 UTSW 1 87088231 missense possibly damaging 0.86
R7910:Alppl2 UTSW 1 87087437 missense probably benign 0.00
Z1176:Alppl2 UTSW 1 87087666 missense probably damaging 1.00
Z1176:Alppl2 UTSW 1 87087704 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGCATCCTAGGGACACAC -3'
(R):5'- GATCAATCAGGTCCCAAGCTC -3'

Sequencing Primer
(F):5'- CCCATGAGGTGTGTCACAGATC -3'
(R):5'- AAGCTCACCTCTGATCGTAGGTG -3'
Posted On2015-03-25