Incidental Mutation 'R3796:Slc24a3'
ID272751
Institutional Source Beutler Lab
Gene Symbol Slc24a3
Ensembl Gene ENSMUSG00000063873
Gene Namesolute carrier family 24 (sodium/potassium/calcium exchanger), member 3
SynonymsNCKX3
MMRRC Submission 040757-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.145) question?
Stock #R3796 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location145167754-145642166 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 145616681 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 527 (D527G)
Ref Sequence ENSEMBL: ENSMUSP00000105634 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081121] [ENSMUST00000110007]
Predicted Effect probably damaging
Transcript: ENSMUST00000081121
AA Change: D477G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000079897
Gene: ENSMUSG00000063873
AA Change: D477G

DomainStartEndE-ValueType
Pfam:Na_Ca_ex 72 204 8.6e-33 PFAM
coiled coil region 353 382 N/A INTRINSIC
Pfam:Na_Ca_ex 437 577 2.1e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110007
AA Change: D527G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105634
Gene: ENSMUSG00000063873
AA Change: D527G

DomainStartEndE-ValueType
low complexity region 11 19 N/A INTRINSIC
transmembrane domain 21 43 N/A INTRINSIC
Pfam:Na_Ca_ex 112 255 2.6e-32 PFAM
coiled coil region 403 432 N/A INTRINSIC
Pfam:Na_Ca_ex 477 629 6.1e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131123
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137908
Meta Mutation Damage Score 0.9480 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Plasma membrane sodium/calcium exchangers are an important component of intracellular calcium homeostasis and electrical conduction. Potassium-dependent sodium/calcium exchangers such as SLC24A3 are believed to transport 1 intracellular calcium and 1 potassium ion in exchange for 4 extracellular sodium ions (Kraev et al., 2001 [PubMed 11294880]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130011E15Rik A G 19: 45,921,610 probably benign Het
Adamts17 A G 7: 66,839,914 probably null Het
Alpk3 C A 7: 81,092,753 P773T probably benign Het
Alppl2 A G 1: 87,088,354 probably null Het
Basp1 C A 15: 25,364,312 probably benign Het
Clec14a G A 12: 58,267,909 A309V probably benign Het
Clk2 A G 3: 89,175,689 N424S probably benign Het
Cops7a C T 6: 124,959,832 R252H probably damaging Het
Csmd2 C T 4: 128,517,595 P2469S probably benign Het
Cwf19l1 A G 19: 44,114,567 V403A probably damaging Het
Dnajc16 G T 4: 141,767,737 D521E probably benign Het
Dnm2 T C 9: 21,505,487 V772A probably benign Het
Dst G T 1: 34,181,915 V2267F probably benign Het
Eif3d A G 15: 77,968,569 F4S probably damaging Het
Fgfr1 G A 8: 25,572,437 D663N probably damaging Het
Hmcn1 A G 1: 150,586,418 Y5170H probably damaging Het
Kcna2 T A 3: 107,105,590 L496I probably benign Het
Krt8 T C 15: 101,999,442 I233V probably benign Het
Mfap1b A G 2: 121,473,905 V3A probably benign Het
Phrf1 C T 7: 141,259,918 R243* probably null Het
Plbd2 A T 5: 120,492,868 I224N probably damaging Het
Rab19 T C 6: 39,384,041 V41A probably benign Het
Rrm1 T A 7: 102,465,703 probably null Het
Sacs T C 14: 61,206,121 V1872A possibly damaging Het
Setd2 T C 9: 110,549,571 V818A probably benign Het
Shprh C T 10: 11,178,757 L1037F possibly damaging Het
Slc27a6 T C 18: 58,598,751 probably benign Het
Slc35g3 A G 11: 69,760,917 F103L probably benign Het
Slc5a1 A G 5: 33,152,652 D408G probably damaging Het
Spag6l A T 16: 16,763,052 I477N probably damaging Het
Srgap1 A G 10: 122,047,132 V21A probably benign Het
Trim7 A G 11: 48,845,670 probably null Het
Trpa1 T C 1: 14,893,264 N578S possibly damaging Het
Xdh T C 17: 73,907,658 E764G probably damaging Het
Zfp518a G T 19: 40,915,310 V1228F probably damaging Het
Other mutations in Slc24a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01295:Slc24a3 APN 2 145616714 critical splice donor site probably null
IGL01327:Slc24a3 APN 2 145602558 missense probably benign
IGL01413:Slc24a3 APN 2 145640249 missense probably damaging 1.00
IGL01418:Slc24a3 APN 2 145640249 missense probably damaging 1.00
IGL01468:Slc24a3 APN 2 145613580 missense probably benign 0.16
IGL01629:Slc24a3 APN 2 145640210 splice site probably benign
IGL01973:Slc24a3 APN 2 145245027 missense probably benign 0.01
IGL02021:Slc24a3 APN 2 145518916 missense probably damaging 1.00
IGL02378:Slc24a3 APN 2 145518402 missense possibly damaging 0.78
R0242:Slc24a3 UTSW 2 145606664 missense probably benign 0.02
R0242:Slc24a3 UTSW 2 145606664 missense probably benign 0.02
R0685:Slc24a3 UTSW 2 145606795 missense probably benign 0.00
R0827:Slc24a3 UTSW 2 145518492 splice site probably benign
R1669:Slc24a3 UTSW 2 145613592 missense probably damaging 1.00
R2698:Slc24a3 UTSW 2 145613567 missense probably benign 0.01
R4073:Slc24a3 UTSW 2 145613716 intron probably benign
R4386:Slc24a3 UTSW 2 145606826 missense probably benign 0.00
R5125:Slc24a3 UTSW 2 145518847 missense possibly damaging 0.95
R5169:Slc24a3 UTSW 2 145640264 missense probably benign 0.18
R5248:Slc24a3 UTSW 2 145604517 missense probably benign 0.40
R5394:Slc24a3 UTSW 2 145613574 missense probably benign 0.42
R5549:Slc24a3 UTSW 2 145606864 missense probably damaging 1.00
R6476:Slc24a3 UTSW 2 145606830 missense probably benign
R6777:Slc24a3 UTSW 2 145640282 missense probably damaging 1.00
R6814:Slc24a3 UTSW 2 145616710 nonsense probably null
R7163:Slc24a3 UTSW 2 145244991 missense probably benign
R7446:Slc24a3 UTSW 2 145580982 missense probably damaging 1.00
R7525:Slc24a3 UTSW 2 145613530 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAGATGTTCATGCCATCCTGTG -3'
(R):5'- TCTGGCCAACTTGACACAGAG -3'

Sequencing Primer
(F):5'- ATGCCATCCTGTGTTAAATCCAG -3'
(R):5'- GGCCAACTTGACACAGAGATGTC -3'
Posted On2015-03-25