Incidental Mutation 'R3796:Clk2'
ID272752
Institutional Source Beutler Lab
Gene Symbol Clk2
Ensembl Gene ENSMUSG00000068917
Gene NameCDC-like kinase 2
Synonyms
MMRRC Submission 040757-MU
Accession Numbers

Genbank: NM_007712, NM_001163432

Is this an essential gene? Possibly non essential (E-score: 0.364) question?
Stock #R3796 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location89164795-89176921 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 89175689 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 424 (N424S)
Ref Sequence ENSEMBL: ENSMUSP00000113861 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029684] [ENSMUST00000090927] [ENSMUST00000098941] [ENSMUST00000120697] [ENSMUST00000121212] [ENSMUST00000121931] [ENSMUST00000128318] [ENSMUST00000148265]
Predicted Effect probably benign
Transcript: ENSMUST00000029684
SMART Domains Protein: ENSMUSP00000029684
Gene: ENSMUSG00000028049

DomainStartEndE-ValueType
low complexity region 49 69 N/A INTRINSIC
coiled coil region 89 127 N/A INTRINSIC
Pfam:SCAMP 133 310 1.5e-76 PFAM
low complexity region 329 348 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090927
AA Change: N422S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000088445
Gene: ENSMUSG00000068917
AA Change: N422S

DomainStartEndE-ValueType
low complexity region 24 50 N/A INTRINSIC
low complexity region 54 72 N/A INTRINSIC
low complexity region 105 137 N/A INTRINSIC
S_TKc 161 477 1.46e-75 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000098941
SMART Domains Protein: ENSMUSP00000096540
Gene: ENSMUSG00000028049

DomainStartEndE-ValueType
low complexity region 49 69 N/A INTRINSIC
coiled coil region 89 127 N/A INTRINSIC
Pfam:SCAMP 133 229 5.5e-46 PFAM
Pfam:SCAMP 227 276 2.2e-11 PFAM
low complexity region 295 314 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120697
SMART Domains Protein: ENSMUSP00000112846
Gene: ENSMUSG00000028049

DomainStartEndE-ValueType
low complexity region 50 70 N/A INTRINSIC
coiled coil region 90 128 N/A INTRINSIC
Pfam:SCAMP 135 310 1.1e-67 PFAM
low complexity region 330 349 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121212
AA Change: N423S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113390
Gene: ENSMUSG00000068917
AA Change: N423S

DomainStartEndE-ValueType
low complexity region 24 50 N/A INTRINSIC
low complexity region 54 73 N/A INTRINSIC
low complexity region 106 138 N/A INTRINSIC
S_TKc 162 478 1.46e-75 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121931
AA Change: N424S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113861
Gene: ENSMUSG00000068917
AA Change: N424S

DomainStartEndE-ValueType
low complexity region 24 50 N/A INTRINSIC
low complexity region 54 73 N/A INTRINSIC
low complexity region 106 142 N/A INTRINSIC
S_TKc 163 479 1.46e-75 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124291
Predicted Effect probably benign
Transcript: ENSMUST00000128318
SMART Domains Protein: ENSMUSP00000115761
Gene: ENSMUSG00000068917

DomainStartEndE-ValueType
low complexity region 24 50 N/A INTRINSIC
low complexity region 54 73 N/A INTRINSIC
low complexity region 103 133 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129294
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132830
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136165
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139221
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138822
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153255
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156447
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148881
Predicted Effect probably benign
Transcript: ENSMUST00000148265
SMART Domains Protein: ENSMUSP00000122634
Gene: ENSMUSG00000068917

DomainStartEndE-ValueType
low complexity region 24 50 N/A INTRINSIC
low complexity region 54 73 N/A INTRINSIC
low complexity region 106 138 N/A INTRINSIC
Pfam:Pkinase 162 249 7.4e-12 PFAM
Meta Mutation Damage Score 0.0602 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a dual specificity protein kinase that phosphorylates serine/threonine and tyrosine-containing substrates. Activity of this protein regulates serine- and arginine-rich (SR) proteins of the spliceosomal complex, thereby influencing alternative transcript splicing. Chromosomal translocations have been characterized between this locus and the PAFAH1B3 (platelet-activating factor acetylhydrolase 1b, catalytic subunit 3 (29kDa)) gene on chromosome 19, resulting in the production of a fusion protein. Note that this gene is distinct from the TELO2 gene (GeneID:9894), which shares the CLK2 alias, but encodes a protein that is involved in telomere length regulation. There is a pseudogene for this gene on chromosome 7. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2014]
PHENOTYPE: Mice homozygous for a conditional allele activated in the liver exhibit decreased hepatic fatty acid oxidation and ketogenesis. [provided by MGI curators]
Allele List at MGI

 All alleles(12) : Targeted, other(1) Gene trapped(11)

Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130011E15Rik A G 19: 45,921,610 probably benign Het
Adamts17 A G 7: 66,839,914 probably null Het
Alpk3 C A 7: 81,092,753 P773T probably benign Het
Alppl2 A G 1: 87,088,354 probably null Het
Basp1 C A 15: 25,364,312 probably benign Het
Clec14a G A 12: 58,267,909 A309V probably benign Het
Cops7a C T 6: 124,959,832 R252H probably damaging Het
Csmd2 C T 4: 128,517,595 P2469S probably benign Het
Cwf19l1 A G 19: 44,114,567 V403A probably damaging Het
Dnajc16 G T 4: 141,767,737 D521E probably benign Het
Dnm2 T C 9: 21,505,487 V772A probably benign Het
Dst G T 1: 34,181,915 V2267F probably benign Het
Eif3d A G 15: 77,968,569 F4S probably damaging Het
Fgfr1 G A 8: 25,572,437 D663N probably damaging Het
Hmcn1 A G 1: 150,586,418 Y5170H probably damaging Het
Kcna2 T A 3: 107,105,590 L496I probably benign Het
Krt8 T C 15: 101,999,442 I233V probably benign Het
Mfap1b A G 2: 121,473,905 V3A probably benign Het
Phrf1 C T 7: 141,259,918 R243* probably null Het
Plbd2 A T 5: 120,492,868 I224N probably damaging Het
Rab19 T C 6: 39,384,041 V41A probably benign Het
Rrm1 T A 7: 102,465,703 probably null Het
Sacs T C 14: 61,206,121 V1872A possibly damaging Het
Setd2 T C 9: 110,549,571 V818A probably benign Het
Shprh C T 10: 11,178,757 L1037F possibly damaging Het
Slc24a3 A G 2: 145,616,681 D527G probably damaging Het
Slc27a6 T C 18: 58,598,751 probably benign Het
Slc35g3 A G 11: 69,760,917 F103L probably benign Het
Slc5a1 A G 5: 33,152,652 D408G probably damaging Het
Spag6l A T 16: 16,763,052 I477N probably damaging Het
Srgap1 A G 10: 122,047,132 V21A probably benign Het
Trim7 A G 11: 48,845,670 probably null Het
Trpa1 T C 1: 14,893,264 N578S possibly damaging Het
Xdh T C 17: 73,907,658 E764G probably damaging Het
Zfp518a G T 19: 40,915,310 V1228F probably damaging Het
Other mutations in Clk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00941:Clk2 APN 3 89175422 missense probably damaging 0.99
IGL01152:Clk2 APN 3 89176511 missense probably damaging 0.99
IGL02342:Clk2 APN 3 89175691 missense probably benign 0.00
IGL02387:Clk2 APN 3 89176391 unclassified probably benign
IGL02553:Clk2 APN 3 89175713 missense probably damaging 1.00
IGL02861:Clk2 APN 3 89173399 missense probably damaging 0.99
3-1:Clk2 UTSW 3 89170348 missense probably damaging 0.98
R1511:Clk2 UTSW 3 89168703 missense probably damaging 1.00
R1892:Clk2 UTSW 3 89175195 missense possibly damaging 0.48
R3844:Clk2 UTSW 3 89170403 missense probably benign 0.06
R4737:Clk2 UTSW 3 89168709 missense probably benign 0.44
R5138:Clk2 UTSW 3 89175499 unclassified probably benign
R5413:Clk2 UTSW 3 89173478 missense probably benign 0.22
R5447:Clk2 UTSW 3 89167191 missense possibly damaging 0.92
R5538:Clk2 UTSW 3 89175655 missense probably damaging 0.99
R6128:Clk2 UTSW 3 89174224 missense probably damaging 1.00
R7346:Clk2 UTSW 3 89173545 critical splice donor site probably null
R7578:Clk2 UTSW 3 89176500 missense probably benign
R7762:Clk2 UTSW 3 89167191 missense probably benign 0.13
R7894:Clk2 UTSW 3 89168894 missense possibly damaging 0.95
R8248:Clk2 UTSW 3 89173504 missense probably damaging 1.00
R8295:Clk2 UTSW 3 89173459 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCGTCTCTCCTCGTGGAATTTG -3'
(R):5'- TGAGGTTATCTGTGAACCCTCG -3'

Sequencing Primer
(F):5'- CTCTCCTCGTGGAATTTGTCTGTTAG -3'
(R):5'- GAGGTTATCTGTGAACCCTCGATCTC -3'
Posted On2015-03-25