Incidental Mutation 'R3796:Dnajc16'
ID 272756
Institutional Source Beutler Lab
Gene Symbol Dnajc16
Ensembl Gene ENSMUSG00000040697
Gene Name DnaJ heat shock protein family (Hsp40) member C16
Synonyms 2900037O03Rik, 4732437J24Rik
MMRRC Submission 040757-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.724) question?
Stock # R3796 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 141487500-141518242 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 141495048 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 521 (D521E)
Ref Sequence ENSEMBL: ENSMUSP00000048714 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038014]
AlphaFold Q80TN4
PDB Structure Solution structure of the J domain of the pseudo DnaJ protein, mouse hypothetical mKIAA0962 [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000038014
AA Change: D521E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000048714
Gene: ENSMUSG00000040697
AA Change: D521E

DomainStartEndE-ValueType
DnaJ 28 85 4.5e-30 SMART
Pfam:Thioredoxin 142 243 4.4e-8 PFAM
low complexity region 537 549 N/A INTRINSIC
low complexity region 730 750 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138654
Meta Mutation Damage Score 0.0737 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts17 A G 7: 66,489,662 (GRCm39) probably null Het
Alpk3 C A 7: 80,742,501 (GRCm39) P773T probably benign Het
Alppl2 A G 1: 87,016,076 (GRCm39) probably null Het
Armh3 A G 19: 45,910,049 (GRCm39) probably benign Het
Basp1 C A 15: 25,364,398 (GRCm39) probably benign Het
Clec14a G A 12: 58,314,695 (GRCm39) A309V probably benign Het
Clk2 A G 3: 89,082,996 (GRCm39) N424S probably benign Het
Cops7a C T 6: 124,936,795 (GRCm39) R252H probably damaging Het
Csmd2 C T 4: 128,411,388 (GRCm39) P2469S probably benign Het
Cwf19l1 A G 19: 44,103,006 (GRCm39) V403A probably damaging Het
Dnm2 T C 9: 21,416,783 (GRCm39) V772A probably benign Het
Dst G T 1: 34,220,996 (GRCm39) V2267F probably benign Het
Eif3d A G 15: 77,852,769 (GRCm39) F4S probably damaging Het
Fgfr1 G A 8: 26,062,453 (GRCm39) D663N probably damaging Het
Hmcn1 A G 1: 150,462,169 (GRCm39) Y5170H probably damaging Het
Kcna2 T A 3: 107,012,906 (GRCm39) L496I probably benign Het
Krt8 T C 15: 101,907,877 (GRCm39) I233V probably benign Het
Mfap1b A G 2: 121,304,386 (GRCm39) V3A probably benign Het
Phrf1 C T 7: 140,839,831 (GRCm39) R243* probably null Het
Plbd2 A T 5: 120,630,933 (GRCm39) I224N probably damaging Het
Rab19 T C 6: 39,360,975 (GRCm39) V41A probably benign Het
Rrm1 T A 7: 102,114,910 (GRCm39) probably null Het
Sacs T C 14: 61,443,570 (GRCm39) V1872A possibly damaging Het
Setd2 T C 9: 110,378,639 (GRCm39) V818A probably benign Het
Shprh C T 10: 11,054,501 (GRCm39) L1037F possibly damaging Het
Slc24a3 A G 2: 145,458,601 (GRCm39) D527G probably damaging Het
Slc27a6 T C 18: 58,731,823 (GRCm39) probably benign Het
Slc35g3 A G 11: 69,651,743 (GRCm39) F103L probably benign Het
Slc5a1 A G 5: 33,309,996 (GRCm39) D408G probably damaging Het
Spag6l A T 16: 16,580,916 (GRCm39) I477N probably damaging Het
Srgap1 A G 10: 121,883,037 (GRCm39) V21A probably benign Het
Trim7 A G 11: 48,736,497 (GRCm39) probably null Het
Trpa1 T C 1: 14,963,488 (GRCm39) N578S possibly damaging Het
Xdh T C 17: 74,214,653 (GRCm39) E764G probably damaging Het
Zfp518a G T 19: 40,903,754 (GRCm39) V1228F probably damaging Het
Other mutations in Dnajc16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Dnajc16 APN 4 141,490,874 (GRCm39) splice site probably null
IGL00840:Dnajc16 APN 4 141,495,314 (GRCm39) missense probably damaging 1.00
IGL01503:Dnajc16 APN 4 141,491,008 (GRCm39) missense possibly damaging 0.65
IGL01919:Dnajc16 APN 4 141,501,940 (GRCm39) missense probably benign 0.06
IGL02065:Dnajc16 APN 4 141,504,244 (GRCm39) missense probably damaging 1.00
IGL02544:Dnajc16 APN 4 141,491,958 (GRCm39) missense probably damaging 1.00
IGL03028:Dnajc16 APN 4 141,495,043 (GRCm39) nonsense probably null
PIT4418001:Dnajc16 UTSW 4 141,498,260 (GRCm39) missense probably damaging 0.99
PIT4585001:Dnajc16 UTSW 4 141,491,996 (GRCm39) missense probably damaging 1.00
R0071:Dnajc16 UTSW 4 141,495,318 (GRCm39) missense probably benign
R0415:Dnajc16 UTSW 4 141,516,359 (GRCm39) nonsense probably null
R0532:Dnajc16 UTSW 4 141,516,320 (GRCm39) missense probably damaging 1.00
R1418:Dnajc16 UTSW 4 141,495,052 (GRCm39) nonsense probably null
R2959:Dnajc16 UTSW 4 141,493,856 (GRCm39) nonsense probably null
R3025:Dnajc16 UTSW 4 141,501,922 (GRCm39) missense probably benign
R3854:Dnajc16 UTSW 4 141,490,964 (GRCm39) nonsense probably null
R3856:Dnajc16 UTSW 4 141,490,964 (GRCm39) nonsense probably null
R4661:Dnajc16 UTSW 4 141,490,859 (GRCm39) missense probably damaging 1.00
R4841:Dnajc16 UTSW 4 141,501,936 (GRCm39) missense probably damaging 1.00
R4842:Dnajc16 UTSW 4 141,501,936 (GRCm39) missense probably damaging 1.00
R5116:Dnajc16 UTSW 4 141,495,280 (GRCm39) nonsense probably null
R5126:Dnajc16 UTSW 4 141,501,820 (GRCm39) missense probably benign 0.01
R5140:Dnajc16 UTSW 4 141,491,994 (GRCm39) missense possibly damaging 0.85
R5275:Dnajc16 UTSW 4 141,495,239 (GRCm39) missense possibly damaging 0.82
R5295:Dnajc16 UTSW 4 141,495,239 (GRCm39) missense possibly damaging 0.82
R5891:Dnajc16 UTSW 4 141,502,703 (GRCm39) missense probably benign
R6888:Dnajc16 UTSW 4 141,504,303 (GRCm39) missense probably benign 0.24
R7062:Dnajc16 UTSW 4 141,494,001 (GRCm39) missense probably damaging 1.00
R7441:Dnajc16 UTSW 4 141,491,124 (GRCm39) missense probably damaging 1.00
R7684:Dnajc16 UTSW 4 141,501,879 (GRCm39) missense probably benign 0.02
R8843:Dnajc16 UTSW 4 141,492,002 (GRCm39) missense possibly damaging 0.87
R8924:Dnajc16 UTSW 4 141,494,018 (GRCm39) nonsense probably null
R9005:Dnajc16 UTSW 4 141,491,945 (GRCm39) missense possibly damaging 0.95
R9053:Dnajc16 UTSW 4 141,510,371 (GRCm39) missense probably benign 0.28
R9550:Dnajc16 UTSW 4 141,495,058 (GRCm39) missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- ACCTATCAGCAAATGGTAAGAAGC -3'
(R):5'- CGGAAGGATCCAGCATTTCTG -3'

Sequencing Primer
(F):5'- TATCAGCAAATGGTAAGAAGCAAAGC -3'
(R):5'- GAAGGATCCAGCATTTCTGTCTTCAG -3'
Posted On 2015-03-25