Mutagenetix > Incidental Mutation

Incidental Mutation 'R3796:Slc5a1'

272757

Institutional Source

Beutler Lab

Gene Symbol

Slc5a1

Ensembl Gene

ENSMUSG00000011034

Gene Name

solute carrier family 5 (sodium/glucose cotransporter), member 1

Synonyms

Sglt1, sodium glucose cotransporter 1

MMRRC Submission

040757-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.300) question?

Stock #

R3796 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

33104219-33162870 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 33152652 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 408 (D408G)

Ref Sequence

ENSEMBL: ENSMUSP00000011178 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000011178]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000011178
AA Change: D408G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000011178
Gene: ENSMUSG00000011034
AA Change: D408G

Domain	Start	End	E-Value	Type
transmembrane domain	26	48	N/A	INTRINSIC
Pfam:SSF	58	492	2.6e-174	PFAM
transmembrane domain	526	548	N/A	INTRINSIC
low complexity region	620	634	N/A	INTRINSIC
transmembrane domain	641	663	N/A	INTRINSIC

Meta Mutation Damage Score

0.9118

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.9%

Validation Efficiency

100% (40/40)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sodium-dependent glucose transporter (SGLT) family. The encoded integral membrane protein is the primary mediator of dietary glucose and galactose uptake from the intestinal lumen. Mutations in this gene have been associated with glucose-galactose malabsorption. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit lethality unless maintained on a glucose-galatose-free diet, distended intestine, impaired glucose transport across the brush border membrane and impaired renal glucose reabsorption. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 35 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9130011E15Rik	A	G	19: 45,921,610		probably benign	Het
Adamts17	A	G	7: 66,839,914		probably null	Het
Alpk3	C	A	7: 81,092,753	P773T	probably benign	Het
Alppl2	A	G	1: 87,088,354		probably null	Het
Basp1	C	A	15: 25,364,312		probably benign	Het
Clec14a	G	A	12: 58,267,909	A309V	probably benign	Het
Clk2	A	G	3: 89,175,689	N424S	probably benign	Het
Cops7a	C	T	6: 124,959,832	R252H	probably damaging	Het
Csmd2	C	T	4: 128,517,595	P2469S	probably benign	Het
Cwf19l1	A	G	19: 44,114,567	V403A	probably damaging	Het
Dnajc16	G	T	4: 141,767,737	D521E	probably benign	Het
Dnm2	T	C	9: 21,505,487	V772A	probably benign	Het
Dst	G	T	1: 34,181,915	V2267F	probably benign	Het
Eif3d	A	G	15: 77,968,569	F4S	probably damaging	Het
Fgfr1	G	A	8: 25,572,437	D663N	probably damaging	Het
Hmcn1	A	G	1: 150,586,418	Y5170H	probably damaging	Het
Kcna2	T	A	3: 107,105,590	L496I	probably benign	Het
Krt8	T	C	15: 101,999,442	I233V	probably benign	Het
Mfap1b	A	G	2: 121,473,905	V3A	probably benign	Het
Phrf1	C	T	7: 141,259,918	R243*	probably null	Het
Plbd2	A	T	5: 120,492,868	I224N	probably damaging	Het
Rab19	T	C	6: 39,384,041	V41A	probably benign	Het
Rrm1	T	A	7: 102,465,703		probably null	Het
Sacs	T	C	14: 61,206,121	V1872A	possibly damaging	Het
Setd2	T	C	9: 110,549,571	V818A	probably benign	Het
Shprh	C	T	10: 11,178,757	L1037F	possibly damaging	Het
Slc24a3	A	G	2: 145,616,681	D527G	probably damaging	Het
Slc27a6	T	C	18: 58,598,751		probably benign	Het
Slc35g3	A	G	11: 69,760,917	F103L	probably benign	Het
Spag6l	A	T	16: 16,763,052	I477N	probably damaging	Het
Srgap1	A	G	10: 122,047,132	V21A	probably benign	Het
Trim7	A	G	11: 48,845,670		probably null	Het
Trpa1	T	C	1: 14,893,264	N578S	possibly damaging	Het
Xdh	T	C	17: 73,907,658	E764G	probably damaging	Het
Zfp518a	G	T	19: 40,915,310	V1228F	probably damaging	Het

Other mutations in Slc5a1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01573:Slc5a1	APN	5	33160865	missense	probably benign
IGL01872:Slc5a1	APN	5	33154637	missense	probably damaging	0.97
IGL01906:Slc5a1	APN	5	33154653	missense	probably damaging	1.00
IGL02614:Slc5a1	APN	5	33154601	missense	probably benign	0.02
IGL03241:Slc5a1	APN	5	33133405	missense	probably benign	0.00
IGL03336:Slc5a1	APN	5	33146943	missense	probably benign	0.24
R0314:Slc5a1	UTSW	5	33146651	missense	probably benign	0.02
R0421:Slc5a1	UTSW	5	33134652	missense	probably damaging	1.00
R0755:Slc5a1	UTSW	5	33133389	missense	probably benign	0.14
R0791:Slc5a1	UTSW	5	33158077	splice site	probably benign
R1506:Slc5a1	UTSW	5	33154708	missense	possibly damaging	0.72
R1801:Slc5a1	UTSW	5	33146953	missense	probably damaging	1.00
R2143:Slc5a1	UTSW	5	33160796	missense	probably benign
R2190:Slc5a1	UTSW	5	33104593	critical splice donor site	probably null
R4423:Slc5a1	UTSW	5	33154674	missense	possibly damaging	0.49
R4465:Slc5a1	UTSW	5	33146516	missense	possibly damaging	0.89
R4588:Slc5a1	UTSW	5	33145288	missense	probably benign	0.01
R4722:Slc5a1	UTSW	5	33146711	missense	possibly damaging	0.86
R4826:Slc5a1	UTSW	5	33159150	missense	probably benign
R4934:Slc5a1	UTSW	5	33104514	missense	probably benign
R4955:Slc5a1	UTSW	5	33160902	missense	probably benign	0.02
R4963:Slc5a1	UTSW	5	33160782	missense	probably benign	0.00
R5008:Slc5a1	UTSW	5	33152573	missense	possibly damaging	0.75
R5094:Slc5a1	UTSW	5	33158280	missense	probably damaging	1.00
R5292:Slc5a1	UTSW	5	33158241	missense	probably benign
R5654:Slc5a1	UTSW	5	33146611	missense	probably benign	0.00
R6784:Slc5a1	UTSW	5	33158116	missense	probably benign	0.00
R7585:Slc5a1	UTSW	5	33160944	missense	probably damaging	1.00
R7734:Slc5a1	UTSW	5	33160935	missense	probably benign
R7751:Slc5a1	UTSW	5	33133417	missense	possibly damaging	0.63
R7827:Slc5a1	UTSW	5	33146713	missense	probably damaging	1.00
R8755:Slc5a1	UTSW	5	33159182	missense	probably benign	0.01
R9433:Slc5a1	UTSW	5	33152681	missense	probably benign	0.00
RF020:Slc5a1	UTSW	5	33133429	missense	probably damaging	1.00
X0064:Slc5a1	UTSW	5	33134636	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GCGATAAATTTGAGGATGCAGC -3'
(R):5'- ACTGGCCATAGAGATAACTCGAG -3'

Sequencing Primer
(F):5'- GATGCAGCATGGTTTCTAAAAGC -3'
(R):5'- ACTCGAGTTATGCCAAGTATCTGC -3'

Posted On

2015-03-25