Incidental Mutation 'R3796:Plbd2'
ID272758
Institutional Source Beutler Lab
Gene Symbol Plbd2
Ensembl Gene ENSMUSG00000029598
Gene Namephospholipase B domain containing 2
Synonyms66.3 kDa, p76, 1300012G16Rik
MMRRC Submission 040757-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R3796 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location120483282-120503625 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 120492868 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 224 (I224N)
Ref Sequence ENSEMBL: ENSMUSP00000031597 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031597]
PDB Structure
Crystal structure of the lysosomal 66.3 kDa protein from mouse solved by S-SAD [X-RAY DIFFRACTION]
Two chain form of the 66.3 kDa protein at 1.8 Angstroem [X-RAY DIFFRACTION]
Two chain form of the 66.3 kDa protein from mouse lacking the linker peptide [X-RAY DIFFRACTION]
One chain form of the 66.3 kDa protein [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000031597
AA Change: I224N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031597
Gene: ENSMUSG00000029598
AA Change: I224N

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:Phospholip_B 62 591 2.9e-179 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131831
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151361
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130011E15Rik A G 19: 45,921,610 probably benign Het
Adamts17 A G 7: 66,839,914 probably null Het
Alpk3 C A 7: 81,092,753 P773T probably benign Het
Alppl2 A G 1: 87,088,354 probably null Het
Basp1 C A 15: 25,364,312 probably benign Het
Clec14a G A 12: 58,267,909 A309V probably benign Het
Clk2 A G 3: 89,175,689 N424S probably benign Het
Cops7a C T 6: 124,959,832 R252H probably damaging Het
Csmd2 C T 4: 128,517,595 P2469S probably benign Het
Cwf19l1 A G 19: 44,114,567 V403A probably damaging Het
Dnajc16 G T 4: 141,767,737 D521E probably benign Het
Dnm2 T C 9: 21,505,487 V772A probably benign Het
Dst G T 1: 34,181,915 V2267F probably benign Het
Eif3d A G 15: 77,968,569 F4S probably damaging Het
Fgfr1 G A 8: 25,572,437 D663N probably damaging Het
Hmcn1 A G 1: 150,586,418 Y5170H probably damaging Het
Kcna2 T A 3: 107,105,590 L496I probably benign Het
Krt8 T C 15: 101,999,442 I233V probably benign Het
Mfap1b A G 2: 121,473,905 V3A probably benign Het
Phrf1 C T 7: 141,259,918 R243* probably null Het
Rab19 T C 6: 39,384,041 V41A probably benign Het
Rrm1 T A 7: 102,465,703 probably null Het
Sacs T C 14: 61,206,121 V1872A possibly damaging Het
Setd2 T C 9: 110,549,571 V818A probably benign Het
Shprh C T 10: 11,178,757 L1037F possibly damaging Het
Slc24a3 A G 2: 145,616,681 D527G probably damaging Het
Slc27a6 T C 18: 58,598,751 probably benign Het
Slc35g3 A G 11: 69,760,917 F103L probably benign Het
Slc5a1 A G 5: 33,152,652 D408G probably damaging Het
Spag6l A T 16: 16,763,052 I477N probably damaging Het
Srgap1 A G 10: 122,047,132 V21A probably benign Het
Trim7 A G 11: 48,845,670 probably null Het
Trpa1 T C 1: 14,893,264 N578S possibly damaging Het
Xdh T C 17: 73,907,658 E764G probably damaging Het
Zfp518a G T 19: 40,915,310 V1228F probably damaging Het
Other mutations in Plbd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00555:Plbd2 APN 5 120485810 missense possibly damaging 0.57
IGL01635:Plbd2 APN 5 120499049 missense probably damaging 1.00
IGL02017:Plbd2 APN 5 120488558 missense probably damaging 1.00
IGL02040:Plbd2 APN 5 120487442 missense probably damaging 1.00
IGL03094:Plbd2 APN 5 120486780 missense probably damaging 1.00
IGL03124:Plbd2 APN 5 120493077 missense possibly damaging 0.68
R0077:Plbd2 UTSW 5 120486039 critical splice donor site probably null
R0087:Plbd2 UTSW 5 120494485 nonsense probably null
R0294:Plbd2 UTSW 5 120487449 splice site probably null
R1682:Plbd2 UTSW 5 120485784 missense probably damaging 0.97
R1818:Plbd2 UTSW 5 120487509 splice site probably null
R4935:Plbd2 UTSW 5 120486721 missense possibly damaging 0.95
R5082:Plbd2 UTSW 5 120491184 nonsense probably null
R5420:Plbd2 UTSW 5 120494482 missense probably damaging 0.98
R5441:Plbd2 UTSW 5 120499082 missense probably benign
R5582:Plbd2 UTSW 5 120493106 missense probably benign 0.00
R5643:Plbd2 UTSW 5 120493166 splice site probably null
R6831:Plbd2 UTSW 5 120493066 missense probably benign 0.03
R6859:Plbd2 UTSW 5 120503342 missense probably benign
R7343:Plbd2 UTSW 5 120493149 missense probably damaging 1.00
R7436:Plbd2 UTSW 5 120486796 missense probably damaging 1.00
R7779:Plbd2 UTSW 5 120487678 missense probably damaging 1.00
R7789:Plbd2 UTSW 5 120485754 missense probably damaging 1.00
R8237:Plbd2 UTSW 5 120499049 missense probably damaging 1.00
Z1177:Plbd2 UTSW 5 120503599 start gained probably benign
Predicted Primers PCR Primer
(F):5'- AACTGCAGCCTGTACTTCTTG -3'
(R):5'- GGAGGTTCACCATCAAACCCTTG -3'

Sequencing Primer
(F):5'- GCCTGTACTTCTTGATGATGCGTAAC -3'
(R):5'- GTGACATGGCGCAAAGTA -3'
Posted On2015-03-25