Incidental Mutation 'R3796:Rab19'
ID272759
Institutional Source Beutler Lab
Gene Symbol Rab19
Ensembl Gene ENSMUSG00000029923
Gene NameRAB19, member RAS oncogene family
Synonyms
MMRRC Submission 040757-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3796 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location39381175-39390380 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 39384041 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 41 (V41A)
Ref Sequence ENSEMBL: ENSMUSP00000031986 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031986]
Predicted Effect probably benign
Transcript: ENSMUST00000031986
AA Change: V41A

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000031986
Gene: ENSMUSG00000029923
AA Change: V41A

DomainStartEndE-ValueType
RAB 18 182 3.39e-99 SMART
Meta Mutation Damage Score 0.0603 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130011E15Rik A G 19: 45,921,610 probably benign Het
Adamts17 A G 7: 66,839,914 probably null Het
Alpk3 C A 7: 81,092,753 P773T probably benign Het
Alppl2 A G 1: 87,088,354 probably null Het
Basp1 C A 15: 25,364,312 probably benign Het
Clec14a G A 12: 58,267,909 A309V probably benign Het
Clk2 A G 3: 89,175,689 N424S probably benign Het
Cops7a C T 6: 124,959,832 R252H probably damaging Het
Csmd2 C T 4: 128,517,595 P2469S probably benign Het
Cwf19l1 A G 19: 44,114,567 V403A probably damaging Het
Dnajc16 G T 4: 141,767,737 D521E probably benign Het
Dnm2 T C 9: 21,505,487 V772A probably benign Het
Dst G T 1: 34,181,915 V2267F probably benign Het
Eif3d A G 15: 77,968,569 F4S probably damaging Het
Fgfr1 G A 8: 25,572,437 D663N probably damaging Het
Hmcn1 A G 1: 150,586,418 Y5170H probably damaging Het
Kcna2 T A 3: 107,105,590 L496I probably benign Het
Krt8 T C 15: 101,999,442 I233V probably benign Het
Mfap1b A G 2: 121,473,905 V3A probably benign Het
Phrf1 C T 7: 141,259,918 R243* probably null Het
Plbd2 A T 5: 120,492,868 I224N probably damaging Het
Rrm1 T A 7: 102,465,703 probably null Het
Sacs T C 14: 61,206,121 V1872A possibly damaging Het
Setd2 T C 9: 110,549,571 V818A probably benign Het
Shprh C T 10: 11,178,757 L1037F possibly damaging Het
Slc24a3 A G 2: 145,616,681 D527G probably damaging Het
Slc27a6 T C 18: 58,598,751 probably benign Het
Slc35g3 A G 11: 69,760,917 F103L probably benign Het
Slc5a1 A G 5: 33,152,652 D408G probably damaging Het
Spag6l A T 16: 16,763,052 I477N probably damaging Het
Srgap1 A G 10: 122,047,132 V21A probably benign Het
Trim7 A G 11: 48,845,670 probably null Het
Trpa1 T C 1: 14,893,264 N578S possibly damaging Het
Xdh T C 17: 73,907,658 E764G probably damaging Het
Zfp518a G T 19: 40,915,310 V1228F probably damaging Het
Other mutations in Rab19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Rab19 APN 6 39388198 splice site probably benign
IGL02188:Rab19 APN 6 39384034 missense probably benign 0.10
IGL02452:Rab19 APN 6 39389798 missense probably benign
IGL03027:Rab19 APN 6 39383993 missense probably damaging 1.00
R0009:Rab19 UTSW 6 39389687 missense probably damaging 1.00
R0312:Rab19 UTSW 6 39384089 missense probably benign 0.02
R0726:Rab19 UTSW 6 39383959 missense probably benign 0.00
R1727:Rab19 UTSW 6 39388161 nonsense probably null
R1954:Rab19 UTSW 6 39384082 missense probably benign 0.06
R2169:Rab19 UTSW 6 39384041 missense possibly damaging 0.49
R4465:Rab19 UTSW 6 39388126 missense probably damaging 1.00
R5977:Rab19 UTSW 6 39383926 missense probably benign 0.07
R6619:Rab19 UTSW 6 39388126 missense probably damaging 0.99
R7489:Rab19 UTSW 6 39388105 missense probably benign 0.09
R8385:Rab19 UTSW 6 39383958 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAAGAAAATGAAGGTAATCTCAGCC -3'
(R):5'- GACTGCAGAAATTATGACCTTTAGG -3'

Sequencing Primer
(F):5'- TGAAGGTAATCTCAGCCCTGGATC -3'
(R):5'- GACTCTGGCCAACTAAAG -3'
Posted On2015-03-25