Mutagenetix > Incidental Mutation

Incidental Mutation 'R3796:Adamts17'

272761

Institutional Source

Beutler Lab

Gene Symbol

Adamts17

Ensembl Gene

ENSMUSG00000058145

Gene Name

a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 17

Synonyms

AU023434

MMRRC Submission

040757-MU

Accession Numbers

Genbank: NM_001033877; MGI: 3588195

Essential gene?

Probably non essential (E-score: 0.071) question?

Stock #

R3796 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

66839735-67153171 bp(+) (GRCm38)

Type of Mutation

splice site (3 bp from exon)

DNA Base Change (assembly)

A to G at 66839914 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000103102 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000098382] [ENSMUST00000098382] [ENSMUST00000107478] [ENSMUST00000107478]

AlphaFold

E9Q4D1

Predicted Effect

probably null
Transcript: ENSMUST00000098382

SMART Domains

Protein: ENSMUSP00000095984
Gene: ENSMUSG00000058145

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
Pfam:Pep_M12B_propep	35	179	2.9e-25	PFAM
Pfam:Reprolysin_5	228	422	3.1e-15	PFAM
Pfam:Reprolysin_2	248	440	6.1e-13	PFAM
Pfam:Reprolysin_3	252	398	2.2e-12	PFAM
Pfam:Reprolysin_4	328	446	7.1e-10	PFAM
Pfam:Reprolysin	334	450	2e-18	PFAM
Blast:ACR	454	533	3e-12	BLAST
TSP1	544	596	2.2e-15	SMART
Pfam:ADAM_spacer1	698	808	6.4e-30	PFAM
TSP1	829	887	1.81e-1	SMART
TSP1	889	942	1.15e-4	SMART
TSP1	949	993	4.05e-5	SMART
TSP1	1000	1054	2.91e-6	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000098382

SMART Domains

Protein: ENSMUSP00000095984
Gene: ENSMUSG00000058145

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
Pfam:Pep_M12B_propep	35	179	2.9e-25	PFAM
Pfam:Reprolysin_5	228	422	3.1e-15	PFAM
Pfam:Reprolysin_2	248	440	6.1e-13	PFAM
Pfam:Reprolysin_3	252	398	2.2e-12	PFAM
Pfam:Reprolysin_4	328	446	7.1e-10	PFAM
Pfam:Reprolysin	334	450	2e-18	PFAM
Blast:ACR	454	533	3e-12	BLAST
TSP1	544	596	2.2e-15	SMART
Pfam:ADAM_spacer1	698	808	6.4e-30	PFAM
TSP1	829	887	1.81e-1	SMART
TSP1	889	942	1.15e-4	SMART
TSP1	949	993	4.05e-5	SMART
TSP1	1000	1054	2.91e-6	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000107478

SMART Domains

Protein: ENSMUSP00000103102
Gene: ENSMUSG00000058145

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
Pfam:Pep_M12B_propep	34	180	3.1e-23	PFAM
Pfam:Reprolysin_5	228	424	3.2e-15	PFAM
Pfam:Reprolysin_2	248	440	5.9e-11	PFAM
Pfam:Reprolysin_3	252	398	6e-12	PFAM
Pfam:Reprolysin_4	328	446	6.8e-10	PFAM
Pfam:Reprolysin	334	450	4.3e-21	PFAM
Blast:ACR	454	533	3e-12	BLAST
TSP1	544	596	2.2e-15	SMART
Pfam:ADAM_spacer1	700	781	2.2e-16	PFAM
TSP1	802	860	1.81e-1	SMART
TSP1	862	915	1.15e-4	SMART
TSP1	922	966	4.05e-5	SMART
TSP1	973	1027	2.91e-6	SMART
Pfam:PLAC	1046	1080	1.1e-10	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000107478

SMART Domains

Protein: ENSMUSP00000103102
Gene: ENSMUSG00000058145

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
Pfam:Pep_M12B_propep	34	180	3.1e-23	PFAM
Pfam:Reprolysin_5	228	424	3.2e-15	PFAM
Pfam:Reprolysin_2	248	440	5.9e-11	PFAM
Pfam:Reprolysin_3	252	398	6e-12	PFAM
Pfam:Reprolysin_4	328	446	6.8e-10	PFAM
Pfam:Reprolysin	334	450	4.3e-21	PFAM
Blast:ACR	454	533	3e-12	BLAST
TSP1	544	596	2.2e-15	SMART
Pfam:ADAM_spacer1	700	781	2.2e-16	PFAM
TSP1	802	860	1.81e-1	SMART
TSP1	862	915	1.15e-4	SMART
TSP1	922	966	4.05e-5	SMART
TSP1	973	1027	2.91e-6	SMART
Pfam:PLAC	1046	1080	1.1e-10	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147880

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148538

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156396

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.9%

Validation Efficiency

100% (40/40)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. ADAMTS family members share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The encoded preproprotein is proteolytically processed to generate the mature protein, which may promote breast cancer cell growth and survival. Mutations in this gene are associated with a Weill-Marchesani-like syndrome, which is characterized by lenticular myopia, ectopia lentis, glaucoma, spherophakia, and short stature. [provided by RefSeq, May 2016]

Allele List at MGI

All alleles(3) : Targeted, other(2) Gene trapped(1)

Other mutations in this stock

Total: 35 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9130011E15Rik	A	G	19: 45,921,610		probably benign	Het
Alpk3	C	A	7: 81,092,753	P773T	probably benign	Het
Alppl2	A	G	1: 87,088,354		probably null	Het
Basp1	C	A	15: 25,364,312		probably benign	Het
Clec14a	G	A	12: 58,267,909	A309V	probably benign	Het
Clk2	A	G	3: 89,175,689	N424S	probably benign	Het
Cops7a	C	T	6: 124,959,832	R252H	probably damaging	Het
Csmd2	C	T	4: 128,517,595	P2469S	probably benign	Het
Cwf19l1	A	G	19: 44,114,567	V403A	probably damaging	Het
Dnajc16	G	T	4: 141,767,737	D521E	probably benign	Het
Dnm2	T	C	9: 21,505,487	V772A	probably benign	Het
Dst	G	T	1: 34,181,915	V2267F	probably benign	Het
Eif3d	A	G	15: 77,968,569	F4S	probably damaging	Het
Fgfr1	G	A	8: 25,572,437	D663N	probably damaging	Het
Hmcn1	A	G	1: 150,586,418	Y5170H	probably damaging	Het
Kcna2	T	A	3: 107,105,590	L496I	probably benign	Het
Krt8	T	C	15: 101,999,442	I233V	probably benign	Het
Mfap1b	A	G	2: 121,473,905	V3A	probably benign	Het
Phrf1	C	T	7: 141,259,918	R243*	probably null	Het
Plbd2	A	T	5: 120,492,868	I224N	probably damaging	Het
Rab19	T	C	6: 39,384,041	V41A	probably benign	Het
Rrm1	T	A	7: 102,465,703		probably null	Het
Sacs	T	C	14: 61,206,121	V1872A	possibly damaging	Het
Setd2	T	C	9: 110,549,571	V818A	probably benign	Het
Shprh	C	T	10: 11,178,757	L1037F	possibly damaging	Het
Slc24a3	A	G	2: 145,616,681	D527G	probably damaging	Het
Slc27a6	T	C	18: 58,598,751		probably benign	Het
Slc35g3	A	G	11: 69,760,917	F103L	probably benign	Het
Slc5a1	A	G	5: 33,152,652	D408G	probably damaging	Het
Spag6l	A	T	16: 16,763,052	I477N	probably damaging	Het
Srgap1	A	G	10: 122,047,132	V21A	probably benign	Het
Trim7	A	G	11: 48,845,670		probably null	Het
Trpa1	T	C	1: 14,893,264	N578S	possibly damaging	Het
Xdh	T	C	17: 73,907,658	E764G	probably damaging	Het
Zfp518a	G	T	19: 40,915,310	V1228F	probably damaging	Het

Other mutations in Adamts17

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00708:Adamts17	APN	7	66968902	missense	probably damaging	1.00
IGL00950:Adamts17	APN	7	67120912	missense	possibly damaging	0.69
IGL01532:Adamts17	APN	7	66908601	missense	probably damaging	1.00
IGL01591:Adamts17	APN	7	67004396	missense	probably damaging	1.00
IGL01602:Adamts17	APN	7	66888411	missense	probably benign	0.29
IGL01640:Adamts17	APN	7	67029680	missense	probably damaging	0.98
IGL01686:Adamts17	APN	7	66840289	missense	probably benign	0.06
IGL01747:Adamts17	APN	7	67052011	missense	probably damaging	1.00
IGL02081:Adamts17	APN	7	67062110	missense	probably damaging	1.00
IGL02152:Adamts17	APN	7	67125000	missense	probably benign	0.01
IGL02264:Adamts17	APN	7	67047459	splice site	probably null
IGL02457:Adamts17	APN	7	67027814	missense	probably damaging	0.99
IGL02519:Adamts17	APN	7	67124973	missense	possibly damaging	0.82
IGL02530:Adamts17	APN	7	66909376	missense	probably damaging	1.00
IGL02649:Adamts17	APN	7	66849878	splice site	probably benign
IGL02711:Adamts17	APN	7	67052040	splice site	probably benign
IGL03006:Adamts17	APN	7	67078347	missense	possibly damaging	0.53
IGL03203:Adamts17	APN	7	67062108	missense	probably damaging	1.00
IGL03343:Adamts17	APN	7	67075316	missense	probably damaging	1.00
BB007:Adamts17	UTSW	7	66849799	missense	probably damaging	0.96
BB017:Adamts17	UTSW	7	66849799	missense	probably damaging	0.96
E2594:Adamts17	UTSW	7	67004350	missense	probably damaging	1.00
R0380:Adamts17	UTSW	7	67150044	missense	probably benign	0.00
R0416:Adamts17	UTSW	7	66915898	splice site	probably null
R0635:Adamts17	UTSW	7	66908605	missense	probably damaging	1.00
R1083:Adamts17	UTSW	7	67147574	missense	probably damaging	1.00
R1476:Adamts17	UTSW	7	67075343	missense	probably damaging	1.00
R1728:Adamts17	UTSW	7	67149956	nonsense	probably null
R1729:Adamts17	UTSW	7	67149956	nonsense	probably null
R1763:Adamts17	UTSW	7	67147715	missense	probably damaging	1.00
R1784:Adamts17	UTSW	7	67149956	nonsense	probably null
R1905:Adamts17	UTSW	7	67047472	nonsense	probably null
R1938:Adamts17	UTSW	7	67125072	missense	probably damaging	1.00
R3106:Adamts17	UTSW	7	67125072	missense	probably damaging	1.00
R3849:Adamts17	UTSW	7	66840467	missense	possibly damaging	0.92
R3850:Adamts17	UTSW	7	66840467	missense	possibly damaging	0.92
R3945:Adamts17	UTSW	7	67120939	missense	probably benign
R4519:Adamts17	UTSW	7	66840566	missense	probably damaging	0.99
R4554:Adamts17	UTSW	7	67027893	missense	probably damaging	1.00
R4555:Adamts17	UTSW	7	67027893	missense	probably damaging	1.00
R4556:Adamts17	UTSW	7	67027893	missense	probably damaging	1.00
R4557:Adamts17	UTSW	7	67027893	missense	probably damaging	1.00
R4700:Adamts17	UTSW	7	67041888	missense	probably damaging	1.00
R4752:Adamts17	UTSW	7	67004470	missense	probably damaging	0.96
R5019:Adamts17	UTSW	7	67062070	nonsense	probably null
R5438:Adamts17	UTSW	7	66888417	missense	probably benign	0.30
R5444:Adamts17	UTSW	7	67041899	missense	probably benign	0.02
R5673:Adamts17	UTSW	7	67041807	missense	probably damaging	1.00
R6326:Adamts17	UTSW	7	67120888	missense	probably benign	0.05
R6964:Adamts17	UTSW	7	66909400	missense	possibly damaging	0.93
R6964:Adamts17	UTSW	7	67004353	missense	probably benign	0.00
R7129:Adamts17	UTSW	7	67121010	missense	probably damaging	1.00
R7317:Adamts17	UTSW	7	66840556	nonsense	probably null
R7355:Adamts17	UTSW	7	67075304	missense
R7386:Adamts17	UTSW	7	66968849	missense	probably benign	0.25
R7407:Adamts17	UTSW	7	67047556	nonsense	probably null
R7432:Adamts17	UTSW	7	67051917	missense
R7782:Adamts17	UTSW	7	67125054	missense	probably damaging	1.00
R7817:Adamts17	UTSW	7	66909476	missense	probably damaging	0.99
R7930:Adamts17	UTSW	7	66849799	missense	probably damaging	0.96
R7993:Adamts17	UTSW	7	66849864	missense	possibly damaging	0.90
R8178:Adamts17	UTSW	7	66849716	missense	possibly damaging	0.46
R8962:Adamts17	UTSW	7	67075309	missense	probably damaging	1.00
R9095:Adamts17	UTSW	7	67004369	missense	probably damaging	1.00
R9111:Adamts17	UTSW	7	66839900	missense	probably damaging	0.96
R9303:Adamts17	UTSW	7	66839897	missense	probably damaging	0.99
R9305:Adamts17	UTSW	7	66839897	missense	probably damaging	0.99
R9505:Adamts17	UTSW	7	67124935	missense	probably benign	0.00
R9668:Adamts17	UTSW	7	67147690	missense	possibly damaging	0.61
X0022:Adamts17	UTSW	7	67041901	missense	probably benign	0.44

Predicted Primers

PCR Primer
(F):5'- TTTTCCAAAGGCTGCAGGGC -3'
(R):5'- ATGGCCACCTGGAGATGCTC -3'

Sequencing Primer
(F):5'- AGGGCTGCACTCCGGTTG -3'
(R):5'- AAGGCTCCGTGGGTATCG -3'

Posted On

2015-03-25