Mutagenetix > Incidental Mutation

Incidental Mutation 'R3796:Rrm1'

272763

Institutional Source

Beutler Lab

Gene Symbol

Rrm1

Ensembl Gene

ENSMUSG00000030978

Gene Name

ribonucleotide reductase M1

Synonyms

RnrM1

MMRRC Submission

040757-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.972) question?

Stock #

R3796 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

102441695-102469771 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to A at 102465703 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000033283 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033283] [ENSMUST00000209630]

AlphaFold

P07742

Predicted Effect

probably null
Transcript: ENSMUST00000033283

SMART Domains

Protein: ENSMUSP00000033283
Gene: ENSMUSG00000030978

Domain	Start	End	E-Value	Type
Pfam:ATP-cone	1	89	8.7e-21	PFAM
Pfam:Ribonuc_red_lgN	141	213	2.8e-25	PFAM
Pfam:Ribonuc_red_lgC	216	738	1.6e-197	PFAM
coiled coil region	749	778	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000209630

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000210543

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.9%

Validation Efficiency

100% (40/40)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the large and catalytic subunit of ribonucleotide reductase, an enzyme essential for the conversion of ribonucleotides into deoxyribonucleotides. A pool of available deoxyribonucleotides is important for DNA replication during S phase of the cell cycle as well as multiple DNA repair processes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic letahlity before E3.5. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 35 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9130011E15Rik	A	G	19: 45,921,610		probably benign	Het
Adamts17	A	G	7: 66,839,914		probably null	Het
Alpk3	C	A	7: 81,092,753	P773T	probably benign	Het
Alppl2	A	G	1: 87,088,354		probably null	Het
Basp1	C	A	15: 25,364,312		probably benign	Het
Clec14a	G	A	12: 58,267,909	A309V	probably benign	Het
Clk2	A	G	3: 89,175,689	N424S	probably benign	Het
Cops7a	C	T	6: 124,959,832	R252H	probably damaging	Het
Csmd2	C	T	4: 128,517,595	P2469S	probably benign	Het
Cwf19l1	A	G	19: 44,114,567	V403A	probably damaging	Het
Dnajc16	G	T	4: 141,767,737	D521E	probably benign	Het
Dnm2	T	C	9: 21,505,487	V772A	probably benign	Het
Dst	G	T	1: 34,181,915	V2267F	probably benign	Het
Eif3d	A	G	15: 77,968,569	F4S	probably damaging	Het
Fgfr1	G	A	8: 25,572,437	D663N	probably damaging	Het
Hmcn1	A	G	1: 150,586,418	Y5170H	probably damaging	Het
Kcna2	T	A	3: 107,105,590	L496I	probably benign	Het
Krt8	T	C	15: 101,999,442	I233V	probably benign	Het
Mfap1b	A	G	2: 121,473,905	V3A	probably benign	Het
Phrf1	C	T	7: 141,259,918	R243*	probably null	Het
Plbd2	A	T	5: 120,492,868	I224N	probably damaging	Het
Rab19	T	C	6: 39,384,041	V41A	probably benign	Het
Sacs	T	C	14: 61,206,121	V1872A	possibly damaging	Het
Setd2	T	C	9: 110,549,571	V818A	probably benign	Het
Shprh	C	T	10: 11,178,757	L1037F	possibly damaging	Het
Slc24a3	A	G	2: 145,616,681	D527G	probably damaging	Het
Slc27a6	T	C	18: 58,598,751		probably benign	Het
Slc35g3	A	G	11: 69,760,917	F103L	probably benign	Het
Slc5a1	A	G	5: 33,152,652	D408G	probably damaging	Het
Spag6l	A	T	16: 16,763,052	I477N	probably damaging	Het
Srgap1	A	G	10: 122,047,132	V21A	probably benign	Het
Trim7	A	G	11: 48,845,670		probably null	Het
Trpa1	T	C	1: 14,893,264	N578S	possibly damaging	Het
Xdh	T	C	17: 73,907,658	E764G	probably damaging	Het
Zfp518a	G	T	19: 40,915,310	V1228F	probably damaging	Het

Other mutations in Rrm1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00087:Rrm1	APN	7	102454507	nonsense	probably null
IGL01431:Rrm1	APN	7	102457552	splice site	probably benign
IGL03251:Rrm1	APN	7	102457206	missense	probably damaging	1.00
IGL03401:Rrm1	APN	7	102465744	missense	possibly damaging	0.81
Arabica	UTSW	7	102460351	missense	probably damaging	1.00
Pentose	UTSW	7	102460856	splice site	probably null
R0454:Rrm1	UTSW	7	102466926	missense	probably damaging	1.00
R0548:Rrm1	UTSW	7	102467067	critical splice donor site	probably null
R0759:Rrm1	UTSW	7	102457561	missense	probably benign	0.32
R1575:Rrm1	UTSW	7	102456514	missense	probably damaging	1.00
R1586:Rrm1	UTSW	7	102466905	makesense	probably null
R1625:Rrm1	UTSW	7	102468347	missense	probably damaging	0.98
R2207:Rrm1	UTSW	7	102442026	start codon destroyed	probably null	0.98
R2432:Rrm1	UTSW	7	102443072	missense	probably benign	0.03
R2513:Rrm1	UTSW	7	102460689	missense	probably damaging	0.99
R3914:Rrm1	UTSW	7	102457174	missense	probably damaging	1.00
R4179:Rrm1	UTSW	7	102457198	missense	probably damaging	1.00
R4302:Rrm1	UTSW	7	102447824	missense	probably benign	0.00
R4379:Rrm1	UTSW	7	102446593	missense	probably damaging	1.00
R4416:Rrm1	UTSW	7	102447801	missense	probably benign	0.06
R4690:Rrm1	UTSW	7	102447879	missense	probably benign
R4939:Rrm1	UTSW	7	102466924	missense	probably benign	0.34
R5433:Rrm1	UTSW	7	102465767	missense	probably damaging	0.97
R5445:Rrm1	UTSW	7	102451023	missense	possibly damaging	0.77
R6120:Rrm1	UTSW	7	102460856	splice site	probably null
R6198:Rrm1	UTSW	7	102446729	critical splice donor site	probably null
R6369:Rrm1	UTSW	7	102446702	missense	probably damaging	0.97
R6699:Rrm1	UTSW	7	102460825	missense	probably damaging	1.00
R7009:Rrm1	UTSW	7	102460334	missense	probably damaging	1.00
R7491:Rrm1	UTSW	7	102454557	missense	probably damaging	1.00
R8024:Rrm1	UTSW	7	102457265	missense	probably benign	0.00
R8276:Rrm1	UTSW	7	102460852	critical splice donor site	probably null
R8713:Rrm1	UTSW	7	102460351	missense	probably damaging	1.00
R8963:Rrm1	UTSW	7	102456532	missense	probably benign	0.23
R8968:Rrm1	UTSW	7	102468338	missense	probably benign	0.03
R9028:Rrm1	UTSW	7	102460398	missense	probably damaging	1.00
R9442:Rrm1	UTSW	7	102459391	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCTCATCTCCCACACTGAAGG -3'
(R):5'- CATGGCACCACAATGCTCAG -3'

Sequencing Primer
(F):5'- GTCTGGATATGCACATACATACAGTC -3'
(R):5'- TGCTCAGCTCAGCTCCTAGAAG -3'

Posted On

2015-03-25