Incidental Mutation 'R3796:Fgfr1'
ID 272765
Institutional Source Beutler Lab
Gene Symbol Fgfr1
Ensembl Gene ENSMUSG00000031565
Gene Name fibroblast growth factor receptor 1
Synonyms Eask, Hspy, Fgfr-1, Flt-2
MMRRC Submission 040757-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R3796 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 25513654-25575718 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 25572437 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Asparagine at position 663 (D663N)
Ref Sequence ENSEMBL: ENSMUSP00000136640 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084027] [ENSMUST00000117179] [ENSMUST00000119398] [ENSMUST00000167764] [ENSMUST00000178276] [ENSMUST00000179592]
AlphaFold P16092
Predicted Effect probably damaging
Transcript: ENSMUST00000084027
AA Change: D652N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000081041
Gene: ENSMUSG00000031565
AA Change: D652N

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IGc2 46 108 2.94e-10 SMART
low complexity region 124 138 N/A INTRINSIC
IGc2 169 237 4.09e-9 SMART
IGc2 268 348 1.26e-9 SMART
transmembrane domain 375 397 N/A INTRINSIC
low complexity region 439 453 N/A INTRINSIC
TyrKc 478 754 1.51e-155 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000117179
AA Change: D650N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113909
Gene: ENSMUSG00000031565
AA Change: D650N

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IGc2 46 108 2.94e-10 SMART
low complexity region 124 138 N/A INTRINSIC
IGc2 167 235 4.09e-9 SMART
IGc2 266 346 1.26e-9 SMART
transmembrane domain 373 395 N/A INTRINSIC
low complexity region 437 451 N/A INTRINSIC
TyrKc 476 752 1.51e-155 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000119398
AA Change: D563N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113855
Gene: ENSMUSG00000031565
AA Change: D563N

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 35 49 N/A INTRINSIC
IGc2 80 148 4.09e-9 SMART
IGc2 179 259 1.26e-9 SMART
transmembrane domain 286 308 N/A INTRINSIC
low complexity region 350 364 N/A INTRINSIC
TyrKc 389 665 1.51e-155 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000120106
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126118
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133936
Predicted Effect probably benign
Transcript: ENSMUST00000138104
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145218
Predicted Effect probably damaging
Transcript: ENSMUST00000167764
AA Change: D563N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131343
Gene: ENSMUSG00000031565
AA Change: D563N

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 35 49 N/A INTRINSIC
IGc2 78 146 4.09e-9 SMART
IGc2 177 255 1.22e-7 SMART
transmembrane domain 286 308 N/A INTRINSIC
low complexity region 350 364 N/A INTRINSIC
TyrKc 389 665 1.51e-155 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000178276
AA Change: D563N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137515
Gene: ENSMUSG00000031565
AA Change: D563N

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 35 49 N/A INTRINSIC
IGc2 78 146 4.09e-9 SMART
IGc2 177 255 1.22e-7 SMART
transmembrane domain 286 308 N/A INTRINSIC
low complexity region 350 364 N/A INTRINSIC
TyrKc 389 665 1.51e-155 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000179592
AA Change: D663N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136640
Gene: ENSMUSG00000031565
AA Change: D663N

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IGc2 59 121 2.94e-10 SMART
low complexity region 137 151 N/A INTRINSIC
IGc2 180 248 4.09e-9 SMART
IGc2 279 359 1.26e-9 SMART
transmembrane domain 386 408 N/A INTRINSIC
low complexity region 450 464 N/A INTRINSIC
TyrKc 489 765 1.51e-155 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210504
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211419
Meta Mutation Damage Score 0.2934 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the fibroblast growth factor receptor (FGFR) family, where amino acid sequence is highly conserved between members and throughout evolution. FGFR family members differ from one another in their ligand affinities and tissue distribution. A full-length representative protein consists of an extracellular region, composed of three immunoglobulin-like domains, a single hydrophobic membrane-spanning segment and a cytoplasmic tyrosine kinase domain. The extracellular portion of the protein interacts with fibroblast growth factors, setting in motion a cascade of downstream signals, ultimately influencing mitogenesis and differentiation. This particular family member binds both acidic and basic fibroblast growth factors and is involved in limb induction. Mutations in this gene have been associated with Pfeiffer syndrome, Jackson-Weiss syndrome, Antley-Bixler syndrome, osteoglophonic dysplasia, and autosomal dominant Kallmann syndrome 2. Chromosomal aberrations involving this gene are associated with stem cell myeloproliferative disorder and stem cell leukemia lymphoma syndrome. Alternatively spliced variants which encode different protein isoforms have been described; however, not all variants have been fully characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations die around gastrulation and show defective patterning of axial structures. Hypomorphic and selectively ablated mutations exhibit a wide range of abnormalities affecting diverse structures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130011E15Rik A G 19: 45,921,610 probably benign Het
Adamts17 A G 7: 66,839,914 probably null Het
Alpk3 C A 7: 81,092,753 P773T probably benign Het
Alppl2 A G 1: 87,088,354 probably null Het
Basp1 C A 15: 25,364,312 probably benign Het
Clec14a G A 12: 58,267,909 A309V probably benign Het
Clk2 A G 3: 89,175,689 N424S probably benign Het
Cops7a C T 6: 124,959,832 R252H probably damaging Het
Csmd2 C T 4: 128,517,595 P2469S probably benign Het
Cwf19l1 A G 19: 44,114,567 V403A probably damaging Het
Dnajc16 G T 4: 141,767,737 D521E probably benign Het
Dnm2 T C 9: 21,505,487 V772A probably benign Het
Dst G T 1: 34,181,915 V2267F probably benign Het
Eif3d A G 15: 77,968,569 F4S probably damaging Het
Hmcn1 A G 1: 150,586,418 Y5170H probably damaging Het
Kcna2 T A 3: 107,105,590 L496I probably benign Het
Krt8 T C 15: 101,999,442 I233V probably benign Het
Mfap1b A G 2: 121,473,905 V3A probably benign Het
Phrf1 C T 7: 141,259,918 R243* probably null Het
Plbd2 A T 5: 120,492,868 I224N probably damaging Het
Rab19 T C 6: 39,384,041 V41A probably benign Het
Rrm1 T A 7: 102,465,703 probably null Het
Sacs T C 14: 61,206,121 V1872A possibly damaging Het
Setd2 T C 9: 110,549,571 V818A probably benign Het
Shprh C T 10: 11,178,757 L1037F possibly damaging Het
Slc24a3 A G 2: 145,616,681 D527G probably damaging Het
Slc27a6 T C 18: 58,598,751 probably benign Het
Slc35g3 A G 11: 69,760,917 F103L probably benign Het
Slc5a1 A G 5: 33,152,652 D408G probably damaging Het
Spag6l A T 16: 16,763,052 I477N probably damaging Het
Srgap1 A G 10: 122,047,132 V21A probably benign Het
Trim7 A G 11: 48,845,670 probably null Het
Trpa1 T C 1: 14,893,264 N578S possibly damaging Het
Xdh T C 17: 73,907,658 E764G probably damaging Het
Zfp518a G T 19: 40,915,310 V1228F probably damaging Het
Other mutations in Fgfr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01413:Fgfr1 APN 8 25562223 nonsense probably null
IGL01537:Fgfr1 APN 8 25555579 missense probably damaging 1.00
IGL01643:Fgfr1 APN 8 25566735 missense probably benign 0.01
IGL01875:Fgfr1 APN 8 25573553 missense possibly damaging 0.81
IGL02002:Fgfr1 APN 8 25555711 missense probably damaging 1.00
IGL02698:Fgfr1 APN 8 25573608 nonsense probably null
IGL02822:Fgfr1 APN 8 25557802 missense probably benign 0.13
IGL03292:Fgfr1 APN 8 25557755 missense possibly damaging 0.50
R0003:Fgfr1 UTSW 8 25568198 missense possibly damaging 0.80
R0723:Fgfr1 UTSW 8 25557768 missense probably damaging 0.99
R0730:Fgfr1 UTSW 8 25555744 missense probably benign
R1144:Fgfr1 UTSW 8 25558143 missense probably damaging 1.00
R1455:Fgfr1 UTSW 8 25562276 missense possibly damaging 0.81
R1591:Fgfr1 UTSW 8 25572720 missense probably damaging 1.00
R1754:Fgfr1 UTSW 8 25570210 missense probably damaging 1.00
R2045:Fgfr1 UTSW 8 25558215 missense probably benign 0.04
R2139:Fgfr1 UTSW 8 25570866 missense probably damaging 1.00
R2314:Fgfr1 UTSW 8 25570893 missense probably damaging 1.00
R2517:Fgfr1 UTSW 8 25563446 missense probably damaging 1.00
R2982:Fgfr1 UTSW 8 25558211 missense probably benign 0.04
R3797:Fgfr1 UTSW 8 25572437 missense probably damaging 1.00
R3799:Fgfr1 UTSW 8 25572437 missense probably damaging 1.00
R4323:Fgfr1 UTSW 8 25573899 missense probably benign 0.37
R4594:Fgfr1 UTSW 8 25573836 missense probably damaging 0.99
R4614:Fgfr1 UTSW 8 25557797 missense probably benign 0.25
R4696:Fgfr1 UTSW 8 25563488 missense probably damaging 0.99
R4916:Fgfr1 UTSW 8 25563526 critical splice donor site probably null
R4966:Fgfr1 UTSW 8 25572445 nonsense probably null
R5094:Fgfr1 UTSW 8 25570165 missense probably damaging 1.00
R5730:Fgfr1 UTSW 8 25573811 missense probably damaging 1.00
R5911:Fgfr1 UTSW 8 25519309 utr 5 prime probably benign
R7310:Fgfr1 UTSW 8 25562315 missense probably benign 0.01
R7326:Fgfr1 UTSW 8 25573839 missense probably damaging 1.00
R7404:Fgfr1 UTSW 8 25555550 missense probably benign
R7611:Fgfr1 UTSW 8 25558205 nonsense probably null
R7681:Fgfr1 UTSW 8 25555661 missense probably damaging 0.98
R7738:Fgfr1 UTSW 8 25558185 missense probably damaging 0.96
R7789:Fgfr1 UTSW 8 25562313 nonsense probably null
R7958:Fgfr1 UTSW 8 25532342 missense probably benign
R8206:Fgfr1 UTSW 8 25570242 missense probably damaging 1.00
R8236:Fgfr1 UTSW 8 25562272 nonsense probably null
R8691:Fgfr1 UTSW 8 25562237 missense possibly damaging 0.95
R9124:Fgfr1 UTSW 8 25570169 missense probably damaging 1.00
R9633:Fgfr1 UTSW 8 25570760 missense probably damaging 1.00
R9704:Fgfr1 UTSW 8 25573563 missense probably benign 0.01
R9798:Fgfr1 UTSW 8 25563507 missense unknown
Z1177:Fgfr1 UTSW 8 25563398 missense probably benign 0.00
Z1177:Fgfr1 UTSW 8 25570768 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- TGTGAAGGCAGAAGACCCTC -3'
(R):5'- GGATGACACAGAGGACTCAC -3'

Sequencing Primer
(F):5'- TCAAGGTAACACGGTCCCG -3'
(R):5'- CGCAGGCAGTGAGTTGAC -3'
Posted On 2015-03-25