Mutagenetix > Incidental Mutation

Incidental Mutation 'R3796:Setd2'

272767

Institutional Source

Beutler Lab

Gene Symbol

Setd2

Ensembl Gene

ENSMUSG00000044791

Gene Name

SET domain containing 2

Synonyms

4921524K10Rik, KMT3A

MMRRC Submission

040757-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.897) question?

Stock #

R3796 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

110532597-110618633 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 110549571 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 818 (V818A)

Ref Sequence

ENSEMBL: ENSMUSP00000116313 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000153838]

AlphaFold

E9Q5F9

Predicted Effect

probably benign
Transcript: ENSMUST00000153838
AA Change: V818A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000116313
Gene: ENSMUSG00000044791
AA Change: V818A

Domain	Start	End	E-Value	Type
low complexity region	19	34	N/A	INTRINSIC
low complexity region	156	176	N/A	INTRINSIC
low complexity region	185	207	N/A	INTRINSIC
low complexity region	297	313	N/A	INTRINSIC
low complexity region	392	419	N/A	INTRINSIC
low complexity region	795	809	N/A	INTRINSIC
low complexity region	867	883	N/A	INTRINSIC
low complexity region	1015	1039	N/A	INTRINSIC
low complexity region	1066	1077	N/A	INTRINSIC
low complexity region	1384	1395	N/A	INTRINSIC
AWS	1468	1523	8.39e-30	SMART
SET	1524	1647	3.07e-41	SMART
PostSET	1648	1664	1.27e-5	SMART
Blast:SET	1689	1714	2e-6	BLAST
low complexity region	1884	1909	N/A	INTRINSIC
low complexity region	1956	1967	N/A	INTRINSIC
coiled coil region	2090	2113	N/A	INTRINSIC
low complexity region	2189	2211	N/A	INTRINSIC
low complexity region	2248	2265	N/A	INTRINSIC
WW	2363	2395	2.1e-11	SMART
Pfam:SRI	2440	2530	6e-30	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000196814
AA Change: V534A

Predicted Effect

probably benign
Transcript: ENSMUST00000198823

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000199595

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.9%

Validation Efficiency

100% (40/40)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Huntington's disease (HD), a neurodegenerative disorder characterized by loss of striatal neurons, is caused by an expansion of a polyglutamine tract in the HD protein huntingtin. This gene encodes a protein belonging to a class of huntingtin interacting proteins characterized by WW motifs. This protein is a histone methyltransferase that is specific for lysine-36 of histone H3, and methylation of this residue is associated with active chromatin. This protein also contains a novel transcriptional activation domain and has been found associated with hyperphosphorylated RNA polymerase II. [provided by RefSeq, Aug 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired embryonic vascular remodeling in the embryo proper, yolk sac, and placenta that leads to death around E10.5. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 35 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9130011E15Rik	A	G	19: 45,921,610		probably benign	Het
Adamts17	A	G	7: 66,839,914		probably null	Het
Alpk3	C	A	7: 81,092,753	P773T	probably benign	Het
Alppl2	A	G	1: 87,088,354		probably null	Het
Basp1	C	A	15: 25,364,312		probably benign	Het
Clec14a	G	A	12: 58,267,909	A309V	probably benign	Het
Clk2	A	G	3: 89,175,689	N424S	probably benign	Het
Cops7a	C	T	6: 124,959,832	R252H	probably damaging	Het
Csmd2	C	T	4: 128,517,595	P2469S	probably benign	Het
Cwf19l1	A	G	19: 44,114,567	V403A	probably damaging	Het
Dnajc16	G	T	4: 141,767,737	D521E	probably benign	Het
Dnm2	T	C	9: 21,505,487	V772A	probably benign	Het
Dst	G	T	1: 34,181,915	V2267F	probably benign	Het
Eif3d	A	G	15: 77,968,569	F4S	probably damaging	Het
Fgfr1	G	A	8: 25,572,437	D663N	probably damaging	Het
Hmcn1	A	G	1: 150,586,418	Y5170H	probably damaging	Het
Kcna2	T	A	3: 107,105,590	L496I	probably benign	Het
Krt8	T	C	15: 101,999,442	I233V	probably benign	Het
Mfap1b	A	G	2: 121,473,905	V3A	probably benign	Het
Phrf1	C	T	7: 141,259,918	R243*	probably null	Het
Plbd2	A	T	5: 120,492,868	I224N	probably damaging	Het
Rab19	T	C	6: 39,384,041	V41A	probably benign	Het
Rrm1	T	A	7: 102,465,703		probably null	Het
Sacs	T	C	14: 61,206,121	V1872A	possibly damaging	Het
Shprh	C	T	10: 11,178,757	L1037F	possibly damaging	Het
Slc24a3	A	G	2: 145,616,681	D527G	probably damaging	Het
Slc27a6	T	C	18: 58,598,751		probably benign	Het
Slc35g3	A	G	11: 69,760,917	F103L	probably benign	Het
Slc5a1	A	G	5: 33,152,652	D408G	probably damaging	Het
Spag6l	A	T	16: 16,763,052	I477N	probably damaging	Het
Srgap1	A	G	10: 122,047,132	V21A	probably benign	Het
Trim7	A	G	11: 48,845,670		probably null	Het
Trpa1	T	C	1: 14,893,264	N578S	possibly damaging	Het
Xdh	T	C	17: 73,907,658	E764G	probably damaging	Het
Zfp518a	G	T	19: 40,915,310	V1228F	probably damaging	Het

Other mutations in Setd2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00722:Setd2	APN	9	110551136	missense	possibly damaging	0.94
IGL01023:Setd2	APN	9	110547513	nonsense	probably null
IGL01063:Setd2	APN	9	110573673	missense	probably damaging	1.00
IGL01745:Setd2	APN	9	110594711	missense	probably damaging	0.99
IGL01911:Setd2	APN	9	110617431	splice site	probably null
IGL01955:Setd2	APN	9	110549318	missense	probably benign	0.38
IGL02023:Setd2	APN	9	110594636	missense	probably benign	0.06
IGL02080:Setd2	APN	9	110547450	splice site	probably null
IGL02412:Setd2	APN	9	110550774	missense	probably benign	0.00
IGL02519:Setd2	APN	9	110553116	missense	probably damaging	0.97
IGL02631:Setd2	APN	9	110550576	missense	possibly damaging	0.80
IGL02754:Setd2	APN	9	110550056	missense	possibly damaging	0.77
IGL02828:Setd2	APN	9	110561214	missense	probably benign	0.31
IGL03033:Setd2	APN	9	110551275	missense	possibly damaging	0.96
IGL03140:Setd2	APN	9	110614952	critical splice donor site	probably null
IGL03378:Setd2	APN	9	110553152	missense	unknown
American_samoa	UTSW	9	110567758	nonsense	probably null
slingshot	UTSW	9	110549507	missense	probably benign	0.00
P0028:Setd2	UTSW	9	110573954	missense	probably benign	0.00
PIT4544001:Setd2	UTSW	9	110551164	missense	probably damaging	1.00
R0058:Setd2	UTSW	9	110594426	missense	probably damaging	0.98
R0058:Setd2	UTSW	9	110594426	missense	probably damaging	0.98
R0167:Setd2	UTSW	9	110573782	missense	probably damaging	1.00
R0408:Setd2	UTSW	9	110594242	missense	probably damaging	1.00
R0452:Setd2	UTSW	9	110553100	splice site	probably null
R0541:Setd2	UTSW	9	110573673	missense	probably damaging	1.00
R0947:Setd2	UTSW	9	110548511	missense	possibly damaging	0.87
R1249:Setd2	UTSW	9	110573880	missense	probably damaging	0.99
R1294:Setd2	UTSW	9	110549507	missense	probably benign	0.00
R1518:Setd2	UTSW	9	110602238	missense	probably damaging	0.98
R1585:Setd2	UTSW	9	110551396	missense	unknown
R1647:Setd2	UTSW	9	110549864	missense	probably benign	0.12
R1649:Setd2	UTSW	9	110549864	missense	probably benign	0.12
R1651:Setd2	UTSW	9	110549864	missense	probably benign	0.12
R1652:Setd2	UTSW	9	110549864	missense	probably benign	0.12
R1673:Setd2	UTSW	9	110604180	missense	probably damaging	0.97
R1703:Setd2	UTSW	9	110549864	missense	probably benign	0.12
R1706:Setd2	UTSW	9	110549864	missense	probably benign	0.12
R1709:Setd2	UTSW	9	110549857	missense	probably benign	0.00
R1752:Setd2	UTSW	9	110594605	missense	probably damaging	1.00
R1796:Setd2	UTSW	9	110550345	missense	probably benign	0.01
R1796:Setd2	UTSW	9	110617816	critical splice acceptor site	probably null
R1812:Setd2	UTSW	9	110550102	missense	probably damaging	0.99
R1884:Setd2	UTSW	9	110556418	critical splice donor site	probably null
R2024:Setd2	UTSW	9	110549133	missense	possibly damaging	0.65
R2051:Setd2	UTSW	9	110550890	missense	probably benign
R2117:Setd2	UTSW	9	110604144	frame shift	probably null
R2120:Setd2	UTSW	9	110549864	missense	probably benign	0.12
R2124:Setd2	UTSW	9	110549864	missense	probably benign	0.12
R2172:Setd2	UTSW	9	110549844	missense	probably benign	0.10
R2179:Setd2	UTSW	9	110594688	nonsense	probably null
R2262:Setd2	UTSW	9	110561243	intron	probably benign
R2411:Setd2	UTSW	9	110550429	missense	possibly damaging	0.46
R2413:Setd2	UTSW	9	110547504	missense	probably damaging	1.00
R2419:Setd2	UTSW	9	110548997	missense	possibly damaging	0.48
R2424:Setd2	UTSW	9	110617522	missense	probably benign	0.37
R3757:Setd2	UTSW	9	110573685	missense	probably damaging	0.99
R3765:Setd2	UTSW	9	110594246	missense	probably damaging	1.00
R3797:Setd2	UTSW	9	110549571	missense	probably benign	0.00
R3799:Setd2	UTSW	9	110549571	missense	probably benign	0.00
R3899:Setd2	UTSW	9	110592518	missense	probably damaging	1.00
R3900:Setd2	UTSW	9	110592518	missense	probably damaging	1.00
R3913:Setd2	UTSW	9	110551046	missense	probably damaging	0.99
R4010:Setd2	UTSW	9	110599195	missense	probably null	1.00
R4580:Setd2	UTSW	9	110574243	missense	probably benign	0.06
R4614:Setd2	UTSW	9	110569813	critical splice donor site	probably null
R4651:Setd2	UTSW	9	110594132	missense	possibly damaging	0.53
R4652:Setd2	UTSW	9	110594132	missense	possibly damaging	0.53
R4855:Setd2	UTSW	9	110571954	missense	probably benign	0.02
R4970:Setd2	UTSW	9	110548158	missense	probably benign	0.28
R5112:Setd2	UTSW	9	110548158	missense	probably benign	0.28
R5123:Setd2	UTSW	9	110617527	missense	possibly damaging	0.76
R5140:Setd2	UTSW	9	110551129	missense	probably benign	0.00
R5202:Setd2	UTSW	9	110551230	missense	probably damaging	1.00
R5290:Setd2	UTSW	9	110617831	missense	probably damaging	1.00
R5560:Setd2	UTSW	9	110549839	nonsense	probably null
R5604:Setd2	UTSW	9	110604216	missense	probably damaging	0.99
R5678:Setd2	UTSW	9	110602186	missense	probably damaging	0.99
R5708:Setd2	UTSW	9	110548823	missense	possibly damaging	0.59
R5763:Setd2	UTSW	9	110556275	splice site	probably null
R5814:Setd2	UTSW	9	110567758	nonsense	probably null
R5924:Setd2	UTSW	9	110574044	missense	probably benign	0.23
R6244:Setd2	UTSW	9	110548665	missense	probably damaging	1.00
R6313:Setd2	UTSW	9	110556366	missense	unknown
R6431:Setd2	UTSW	9	110550385	missense	possibly damaging	0.65
R6526:Setd2	UTSW	9	110532717	missense	probably benign	0.33
R6579:Setd2	UTSW	9	110549778	missense	possibly damaging	0.87
R6996:Setd2	UTSW	9	110550572	missense	probably damaging	0.99
R7012:Setd2	UTSW	9	110547683	missense	probably damaging	0.97
R7105:Setd2	UTSW	9	110548260	missense	probably damaging	1.00
R7134:Setd2	UTSW	9	110548797	missense	possibly damaging	0.87
R7222:Setd2	UTSW	9	110551462	missense
R7359:Setd2	UTSW	9	110562944	missense
R7492:Setd2	UTSW	9	110594632	missense
R7643:Setd2	UTSW	9	110567840	splice site	probably null
R7869:Setd2	UTSW	9	110550014	nonsense	probably null
R7903:Setd2	UTSW	9	110617837	missense
R8004:Setd2	UTSW	9	110592545	missense
R8017:Setd2	UTSW	9	110602187	missense
R8019:Setd2	UTSW	9	110602187	missense
R8366:Setd2	UTSW	9	110548748	missense	probably damaging	1.00
R8460:Setd2	UTSW	9	110594270	missense
R8498:Setd2	UTSW	9	110549921	missense	probably damaging	0.99
R8725:Setd2	UTSW	9	110573844	missense
R8870:Setd2	UTSW	9	110594253	missense
R8878:Setd2	UTSW	9	110592399	missense	probably benign
R9132:Setd2	UTSW	9	110545317	critical splice donor site	probably null
R9159:Setd2	UTSW	9	110545317	critical splice donor site	probably null
R9198:Setd2	UTSW	9	110549100	missense	possibly damaging	0.77
R9277:Setd2	UTSW	9	110550551	missense	probably damaging	1.00
R9326:Setd2	UTSW	9	110549603	missense	probably benign	0.00
R9558:Setd2	UTSW	9	110547560	missense	probably damaging	0.99
R9664:Setd2	UTSW	9	110548502	missense	probably damaging	1.00
R9673:Setd2	UTSW	9	110549070	missense	probably damaging	1.00
RF009:Setd2	UTSW	9	110550711	missense	probably damaging	1.00
Z1176:Setd2	UTSW	9	110532726	missense	possibly damaging	0.85
Z1176:Setd2	UTSW	9	110547275	missense	probably damaging	0.99
Z1176:Setd2	UTSW	9	110547579	missense	probably damaging	0.97
Z1177:Setd2	UTSW	9	110547476	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGAACCTTTGTTGTCACCAC -3'
(R):5'- CACATCTTATTCCTGACGGAGG -3'

Sequencing Primer
(F):5'- TTGTTGTCACCACACCATGATAAAC -3'
(R):5'- ACTCTGGAGAGATGAAATACCTG -3'

Posted On

2015-03-25