Mutagenetix > Incidental Mutations

Incidental Mutation 'R3796:Srgap1'

272769

Institutional Source

Beutler Lab

Gene Symbol

Srgap1

Ensembl Gene

ENSMUSG00000020121

Gene Name

SLIT-ROBO Rho GTPase activating protein 1

Synonyms

Arhgap13, 4930572H05Rik

MMRRC Submission

040757-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.340) question?

Stock #

R3796 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

121780991-122047315 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 122047132 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 21 (V21A)

Ref Sequence

ENSEMBL: ENSMUSP00000020322 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020322] [ENSMUST00000081688]

PDB Structure

Crystal structure of srGAP1 SH3 domain in the slit-robo signaling pathway [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000020322
AA Change: V21A

PolyPhen 2 Score 0.061 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000020322
Gene: ENSMUSG00000020121
AA Change: V21A

Domain	Start	End	E-Value	Type
FCH	22	121	3.81e-16	SMART
low complexity region	173	193	N/A	INTRINSIC
coiled coil region	352	382	N/A	INTRINSIC
low complexity region	405	418	N/A	INTRINSIC
RhoGAP	494	668	1.27e-64	SMART
SH3	723	778	1.57e-14	SMART
low complexity region	826	840	N/A	INTRINSIC
low complexity region	1004	1014	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000081688
AA Change: V21A

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000080389
Gene: ENSMUSG00000020121
AA Change: V21A

Domain	Start	End	E-Value	Type
FCH	22	121	3.81e-16	SMART
low complexity region	173	193	N/A	INTRINSIC
coiled coil region	352	382	N/A	INTRINSIC
low complexity region	405	418	N/A	INTRINSIC
RhoGAP	517	691	1.27e-64	SMART
SH3	746	801	1.57e-14	SMART
low complexity region	849	863	N/A	INTRINSIC
low complexity region	1027	1037	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162710

Meta Mutation Damage Score

0.0852

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.9%

Validation Efficiency

100% (40/40)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a GTPase activator, working with the GTPase CDC42 to negatively regulate neuronal migration. The encoded protein interacts with the transmembrane receptor ROBO1 to inactivate CDC42. [provided by RefSeq, Sep 2016]

Allele List at MGI

Other mutations in this stock

Total: 35 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9130011E15Rik	A	G	19: 45,921,610		probably benign	Het
Adamts17	A	G	7: 66,839,914		probably null	Het
Alpk3	C	A	7: 81,092,753	P773T	probably benign	Het
Alppl2	A	G	1: 87,088,354		probably null	Het
Basp1	C	A	15: 25,364,312		probably benign	Het
Clec14a	G	A	12: 58,267,909	A309V	probably benign	Het
Clk2	A	G	3: 89,175,689	N424S	probably benign	Het
Cops7a	C	T	6: 124,959,832	R252H	probably damaging	Het
Csmd2	C	T	4: 128,517,595	P2469S	probably benign	Het
Cwf19l1	A	G	19: 44,114,567	V403A	probably damaging	Het
Dnajc16	G	T	4: 141,767,737	D521E	probably benign	Het
Dnm2	T	C	9: 21,505,487	V772A	probably benign	Het
Dst	G	T	1: 34,181,915	V2267F	probably benign	Het
Eif3d	A	G	15: 77,968,569	F4S	probably damaging	Het
Fgfr1	G	A	8: 25,572,437	D663N	probably damaging	Het
Hmcn1	A	G	1: 150,586,418	Y5170H	probably damaging	Het
Kcna2	T	A	3: 107,105,590	L496I	probably benign	Het
Krt8	T	C	15: 101,999,442	I233V	probably benign	Het
Mfap1b	A	G	2: 121,473,905	V3A	probably benign	Het
Phrf1	C	T	7: 141,259,918	R243*	probably null	Het
Plbd2	A	T	5: 120,492,868	I224N	probably damaging	Het
Rab19	T	C	6: 39,384,041	V41A	probably benign	Het
Rrm1	T	A	7: 102,465,703		probably null	Het
Sacs	T	C	14: 61,206,121	V1872A	possibly damaging	Het
Setd2	T	C	9: 110,549,571	V818A	probably benign	Het
Shprh	C	T	10: 11,178,757	L1037F	possibly damaging	Het
Slc24a3	A	G	2: 145,616,681	D527G	probably damaging	Het
Slc27a6	T	C	18: 58,598,751		probably benign	Het
Slc35g3	A	G	11: 69,760,917	F103L	probably benign	Het
Slc5a1	A	G	5: 33,152,652	D408G	probably damaging	Het
Spag6l	A	T	16: 16,763,052	I477N	probably damaging	Het
Trim7	A	G	11: 48,845,670		probably null	Het
Trpa1	T	C	1: 14,893,264	N578S	possibly damaging	Het
Xdh	T	C	17: 73,907,658	E764G	probably damaging	Het
Zfp518a	G	T	19: 40,915,310	V1228F	probably damaging	Het

Other mutations in Srgap1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01964:Srgap1	APN	10	121804966	missense	possibly damaging	0.81
IGL02106:Srgap1	APN	10	121785693	missense	possibly damaging	0.95
IGL02927:Srgap1	APN	10	121855462	missense	probably damaging	0.99
IGL03088:Srgap1	APN	10	121825693	missense	possibly damaging	0.94
IGL03208:Srgap1	APN	10	121792266	missense	possibly damaging	0.89
IGL03251:Srgap1	APN	10	121804921	unclassified	probably null
PIT1430001:Srgap1	UTSW	10	121896753	splice site	probably benign
R0052:Srgap1	UTSW	10	121800827	missense	possibly damaging	0.94
R0052:Srgap1	UTSW	10	121800827	missense	possibly damaging	0.94
R0356:Srgap1	UTSW	10	121855536	splice site	probably null
R0361:Srgap1	UTSW	10	122047192	start codon destroyed	probably null	0.89
R0365:Srgap1	UTSW	10	121785705	missense	possibly damaging	0.80
R0675:Srgap1	UTSW	10	121792235	missense	probably damaging	1.00
R0801:Srgap1	UTSW	10	121807875	missense	probably damaging	0.96
R0815:Srgap1	UTSW	10	121785474	missense	probably damaging	0.99
R1034:Srgap1	UTSW	10	121785445	missense	possibly damaging	0.69
R1160:Srgap1	UTSW	10	121855477	missense	probably benign	0.01
R1454:Srgap1	UTSW	10	121896738	missense	probably damaging	0.99
R1624:Srgap1	UTSW	10	121855373	missense	probably benign	0.03
R1628:Srgap1	UTSW	10	121870339	missense	probably benign	0.15
R1816:Srgap1	UTSW	10	121925971	nonsense	probably null
R1933:Srgap1	UTSW	10	121925903	missense	possibly damaging	0.89
R2034:Srgap1	UTSW	10	121792746	missense	probably damaging	0.98
R2211:Srgap1	UTSW	10	121853740	missense	possibly damaging	0.55
R2295:Srgap1	UTSW	10	121794760	missense	probably benign	0.03
R2368:Srgap1	UTSW	10	121829289	missense	probably benign	0.05
R4083:Srgap1	UTSW	10	121785690	missense	probably damaging	1.00
R4172:Srgap1	UTSW	10	121855363	missense	probably benign	0.00
R4322:Srgap1	UTSW	10	121869806	missense	probably damaging	1.00
R4401:Srgap1	UTSW	10	121804921	unclassified	probably null
R4513:Srgap1	UTSW	10	121870326	critical splice donor site	probably null
R4698:Srgap1	UTSW	10	121792487	missense	probably benign	0.22
R4776:Srgap1	UTSW	10	121792351	missense	probably benign	0.03
R4951:Srgap1	UTSW	10	121785552	missense	probably benign	0.20
R5116:Srgap1	UTSW	10	121792379	missense	possibly damaging	0.77
R5232:Srgap1	UTSW	10	121840911	missense	probably benign	0.00
R5237:Srgap1	UTSW	10	121807883	missense	probably damaging	1.00
R5335:Srgap1	UTSW	10	121785377	utr 3 prime	probably benign
R5402:Srgap1	UTSW	10	121785760	missense	probably benign	0.06
R5432:Srgap1	UTSW	10	121869823	missense	probably damaging	1.00
R5456:Srgap1	UTSW	10	121869811	missense	probably benign	0.45
R5669:Srgap1	UTSW	10	121804850	missense	probably benign	0.00
R5682:Srgap1	UTSW	10	121805014	missense	probably damaging	1.00
R5687:Srgap1	UTSW	10	121825636	missense	probably damaging	1.00
R5773:Srgap1	UTSW	10	121896709	missense	probably benign	0.02
R5832:Srgap1	UTSW	10	121840914	missense	probably damaging	1.00
R6028:Srgap1	UTSW	10	121828730	missense	probably null
R6240:Srgap1	UTSW	10	122047156	missense	probably benign	0.06
R6336:Srgap1	UTSW	10	121925941	missense	probably benign	0.01
R6435:Srgap1	UTSW	10	121800827	missense	possibly damaging	0.94
R6597:Srgap1	UTSW	10	121792371	missense	probably benign	0.11
R6798:Srgap1	UTSW	10	121925904	missense	probably damaging	1.00
R6807:Srgap1	UTSW	10	121828726	splice site	probably null
R6897:Srgap1	UTSW	10	121785618	missense	probably damaging	0.96
R7057:Srgap1	UTSW	10	121804953	missense	probably benign	0.20
R7196:Srgap1	UTSW	10	121840848	missense	probably benign	0.00
R7247:Srgap1	UTSW	10	121869790	missense	probably damaging	0.98
R7404:Srgap1	UTSW	10	121785745	missense	probably benign	0.18
R7467:Srgap1	UTSW	10	121855439	nonsense	probably null
R7792:Srgap1	UTSW	10	121925967	missense	probably damaging	0.98
R7846:Srgap1	UTSW	10	121785492	missense	probably damaging	0.97
R7896:Srgap1	UTSW	10	121853553	critical splice donor site	probably benign
R7912:Srgap1	UTSW	10	121853553	critical splice donor site	probably benign
R7929:Srgap1	UTSW	10	121785492	missense	probably damaging	0.97
X0063:Srgap1	UTSW	10	121785412	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- TTAAGTTCCAGCCTGTTGGG -3'
(R):5'- TCTCTGCGAGAGGGAGTTAC -3'

Sequencing Primer
(F):5'- TTCCAGCCTGTTGGGAGACAG -3'
(R):5'- CTCTGCGAGAGGGAGTTACAACTC -3'

Posted On

2015-03-25