Incidental Mutation 'R3796:Trim7'
ID 272770
Institutional Source Beutler Lab
Gene Symbol Trim7
Ensembl Gene ENSMUSG00000040350
Gene Name tripartite motif-containing 7
Synonyms
MMRRC Submission 040757-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.084) question?
Stock # R3796 (G1)
Quality Score 159
Status Validated
Chromosome 11
Chromosomal Location 48716965-48742019 bp(+) (GRCm39)
Type of Mutation splice site (4 bp from exon)
DNA Base Change (assembly) A to G at 48736497 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000104836 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046903] [ENSMUST00000109213] [ENSMUST00000129674] [ENSMUST00000149049] [ENSMUST00000155478]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000046903
SMART Domains Protein: ENSMUSP00000039011
Gene: ENSMUSG00000040350

DomainStartEndE-ValueType
low complexity region 12 27 N/A INTRINSIC
RING 29 80 2.95e-7 SMART
BBOX 124 165 3.23e-13 SMART
low complexity region 232 244 N/A INTRINSIC
coiled coil region 246 271 N/A INTRINSIC
low complexity region 285 304 N/A INTRINSIC
PRY 340 392 4.61e-18 SMART
SPRY 393 506 1.63e-19 SMART
Predicted Effect probably null
Transcript: ENSMUST00000109213
SMART Domains Protein: ENSMUSP00000104836
Gene: ENSMUSG00000040350

DomainStartEndE-ValueType
low complexity region 25 37 N/A INTRINSIC
coiled coil region 39 64 N/A INTRINSIC
low complexity region 78 97 N/A INTRINSIC
PRY 133 185 4.61e-18 SMART
SPRY 186 299 1.63e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129674
SMART Domains Protein: ENSMUSP00000116067
Gene: ENSMUSG00000040350

DomainStartEndE-ValueType
low complexity region 25 37 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131270
Predicted Effect probably benign
Transcript: ENSMUST00000149049
Predicted Effect probably benign
Transcript: ENSMUST00000155478
SMART Domains Protein: ENSMUSP00000118669
Gene: ENSMUSG00000040350

DomainStartEndE-ValueType
low complexity region 12 27 N/A INTRINSIC
RING 29 80 2.95e-7 SMART
BBOX 124 165 3.23e-13 SMART
low complexity region 221 238 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156882
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1, a B-box type 2, and a coiled-coil region. The protein localizes to both the nucleus and the cytoplasm, and may represent a participant in the initiation of glycogen synthesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts17 A G 7: 66,489,662 (GRCm39) probably null Het
Alpk3 C A 7: 80,742,501 (GRCm39) P773T probably benign Het
Alppl2 A G 1: 87,016,076 (GRCm39) probably null Het
Armh3 A G 19: 45,910,049 (GRCm39) probably benign Het
Basp1 C A 15: 25,364,398 (GRCm39) probably benign Het
Clec14a G A 12: 58,314,695 (GRCm39) A309V probably benign Het
Clk2 A G 3: 89,082,996 (GRCm39) N424S probably benign Het
Cops7a C T 6: 124,936,795 (GRCm39) R252H probably damaging Het
Csmd2 C T 4: 128,411,388 (GRCm39) P2469S probably benign Het
Cwf19l1 A G 19: 44,103,006 (GRCm39) V403A probably damaging Het
Dnajc16 G T 4: 141,495,048 (GRCm39) D521E probably benign Het
Dnm2 T C 9: 21,416,783 (GRCm39) V772A probably benign Het
Dst G T 1: 34,220,996 (GRCm39) V2267F probably benign Het
Eif3d A G 15: 77,852,769 (GRCm39) F4S probably damaging Het
Fgfr1 G A 8: 26,062,453 (GRCm39) D663N probably damaging Het
Hmcn1 A G 1: 150,462,169 (GRCm39) Y5170H probably damaging Het
Kcna2 T A 3: 107,012,906 (GRCm39) L496I probably benign Het
Krt8 T C 15: 101,907,877 (GRCm39) I233V probably benign Het
Mfap1b A G 2: 121,304,386 (GRCm39) V3A probably benign Het
Phrf1 C T 7: 140,839,831 (GRCm39) R243* probably null Het
Plbd2 A T 5: 120,630,933 (GRCm39) I224N probably damaging Het
Rab19 T C 6: 39,360,975 (GRCm39) V41A probably benign Het
Rrm1 T A 7: 102,114,910 (GRCm39) probably null Het
Sacs T C 14: 61,443,570 (GRCm39) V1872A possibly damaging Het
Setd2 T C 9: 110,378,639 (GRCm39) V818A probably benign Het
Shprh C T 10: 11,054,501 (GRCm39) L1037F possibly damaging Het
Slc24a3 A G 2: 145,458,601 (GRCm39) D527G probably damaging Het
Slc27a6 T C 18: 58,731,823 (GRCm39) probably benign Het
Slc35g3 A G 11: 69,651,743 (GRCm39) F103L probably benign Het
Slc5a1 A G 5: 33,309,996 (GRCm39) D408G probably damaging Het
Spag6l A T 16: 16,580,916 (GRCm39) I477N probably damaging Het
Srgap1 A G 10: 121,883,037 (GRCm39) V21A probably benign Het
Trpa1 T C 1: 14,963,488 (GRCm39) N578S possibly damaging Het
Xdh T C 17: 74,214,653 (GRCm39) E764G probably damaging Het
Zfp518a G T 19: 40,903,754 (GRCm39) V1228F probably damaging Het
Other mutations in Trim7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Trim7 APN 11 48,736,398 (GRCm39) missense probably damaging 0.99
IGL00476:Trim7 APN 11 48,738,905 (GRCm39) missense probably benign 0.39
R0119:Trim7 UTSW 11 48,740,539 (GRCm39) missense probably damaging 1.00
R0308:Trim7 UTSW 11 48,740,328 (GRCm39) missense probably damaging 0.96
R0546:Trim7 UTSW 11 48,736,336 (GRCm39) missense probably damaging 1.00
R1067:Trim7 UTSW 11 48,728,646 (GRCm39) missense probably damaging 0.99
R1081:Trim7 UTSW 11 48,740,532 (GRCm39) missense probably damaging 1.00
R2139:Trim7 UTSW 11 48,729,721 (GRCm39) missense probably benign 0.06
R3797:Trim7 UTSW 11 48,736,497 (GRCm39) splice site probably null
R3901:Trim7 UTSW 11 48,728,435 (GRCm39) missense probably damaging 0.98
R4157:Trim7 UTSW 11 48,738,920 (GRCm39) missense probably benign 0.00
R4603:Trim7 UTSW 11 48,728,355 (GRCm39) start codon destroyed probably null 0.98
R5429:Trim7 UTSW 11 48,740,782 (GRCm39) missense probably damaging 1.00
R5915:Trim7 UTSW 11 48,736,477 (GRCm39) missense possibly damaging 0.95
R5988:Trim7 UTSW 11 48,728,513 (GRCm39) missense probably benign 0.01
R7960:Trim7 UTSW 11 48,728,628 (GRCm39) missense probably damaging 0.99
R8100:Trim7 UTSW 11 48,740,346 (GRCm39) missense probably damaging 1.00
R9121:Trim7 UTSW 11 48,740,674 (GRCm39) missense probably damaging 1.00
R9289:Trim7 UTSW 11 48,736,281 (GRCm39) nonsense probably null
R9574:Trim7 UTSW 11 48,728,460 (GRCm39) missense probably damaging 1.00
R9581:Trim7 UTSW 11 48,738,887 (GRCm39) missense probably damaging 1.00
Z1176:Trim7 UTSW 11 48,740,720 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCCGAGACAGAAGCAGATG -3'
(R):5'- AGAGACTTTGGACTCAAGTGTG -3'

Sequencing Primer
(F):5'- TAGGGGCGGAGTTCCAAGC -3'
(R):5'- ACTTTGGACTCAAGTGTGTGTAGAC -3'
Posted On 2015-03-25