Incidental Mutation 'R3796:Trim7'
ID272770
Institutional Source Beutler Lab
Gene Symbol Trim7
Ensembl Gene ENSMUSG00000040350
Gene Nametripartite motif-containing 7
Synonyms
MMRRC Submission 040757-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R3796 (G1)
Quality Score159
Status Validated
Chromosome11
Chromosomal Location48826140-48852209 bp(+) (GRCm38)
Type of Mutationsplice site (4 bp from exon)
DNA Base Change (assembly) A to G at 48845670 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000104836 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046903] [ENSMUST00000109213] [ENSMUST00000129674] [ENSMUST00000149049] [ENSMUST00000155478]
Predicted Effect probably null
Transcript: ENSMUST00000046903
SMART Domains Protein: ENSMUSP00000039011
Gene: ENSMUSG00000040350

DomainStartEndE-ValueType
low complexity region 12 27 N/A INTRINSIC
RING 29 80 2.95e-7 SMART
BBOX 124 165 3.23e-13 SMART
low complexity region 232 244 N/A INTRINSIC
coiled coil region 246 271 N/A INTRINSIC
low complexity region 285 304 N/A INTRINSIC
PRY 340 392 4.61e-18 SMART
SPRY 393 506 1.63e-19 SMART
Predicted Effect probably null
Transcript: ENSMUST00000109213
SMART Domains Protein: ENSMUSP00000104836
Gene: ENSMUSG00000040350

DomainStartEndE-ValueType
low complexity region 25 37 N/A INTRINSIC
coiled coil region 39 64 N/A INTRINSIC
low complexity region 78 97 N/A INTRINSIC
PRY 133 185 4.61e-18 SMART
SPRY 186 299 1.63e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129674
SMART Domains Protein: ENSMUSP00000116067
Gene: ENSMUSG00000040350

DomainStartEndE-ValueType
low complexity region 25 37 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131270
Predicted Effect probably benign
Transcript: ENSMUST00000149049
Predicted Effect probably benign
Transcript: ENSMUST00000155478
SMART Domains Protein: ENSMUSP00000118669
Gene: ENSMUSG00000040350

DomainStartEndE-ValueType
low complexity region 12 27 N/A INTRINSIC
RING 29 80 2.95e-7 SMART
BBOX 124 165 3.23e-13 SMART
low complexity region 221 238 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156882
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1, a B-box type 2, and a coiled-coil region. The protein localizes to both the nucleus and the cytoplasm, and may represent a participant in the initiation of glycogen synthesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130011E15Rik A G 19: 45,921,610 probably benign Het
Adamts17 A G 7: 66,839,914 probably null Het
Alpk3 C A 7: 81,092,753 P773T probably benign Het
Alppl2 A G 1: 87,088,354 probably null Het
Basp1 C A 15: 25,364,312 probably benign Het
Clec14a G A 12: 58,267,909 A309V probably benign Het
Clk2 A G 3: 89,175,689 N424S probably benign Het
Cops7a C T 6: 124,959,832 R252H probably damaging Het
Csmd2 C T 4: 128,517,595 P2469S probably benign Het
Cwf19l1 A G 19: 44,114,567 V403A probably damaging Het
Dnajc16 G T 4: 141,767,737 D521E probably benign Het
Dnm2 T C 9: 21,505,487 V772A probably benign Het
Dst G T 1: 34,181,915 V2267F probably benign Het
Eif3d A G 15: 77,968,569 F4S probably damaging Het
Fgfr1 G A 8: 25,572,437 D663N probably damaging Het
Hmcn1 A G 1: 150,586,418 Y5170H probably damaging Het
Kcna2 T A 3: 107,105,590 L496I probably benign Het
Krt8 T C 15: 101,999,442 I233V probably benign Het
Mfap1b A G 2: 121,473,905 V3A probably benign Het
Phrf1 C T 7: 141,259,918 R243* probably null Het
Plbd2 A T 5: 120,492,868 I224N probably damaging Het
Rab19 T C 6: 39,384,041 V41A probably benign Het
Rrm1 T A 7: 102,465,703 probably null Het
Sacs T C 14: 61,206,121 V1872A possibly damaging Het
Setd2 T C 9: 110,549,571 V818A probably benign Het
Shprh C T 10: 11,178,757 L1037F possibly damaging Het
Slc24a3 A G 2: 145,616,681 D527G probably damaging Het
Slc27a6 T C 18: 58,598,751 probably benign Het
Slc35g3 A G 11: 69,760,917 F103L probably benign Het
Slc5a1 A G 5: 33,152,652 D408G probably damaging Het
Spag6l A T 16: 16,763,052 I477N probably damaging Het
Srgap1 A G 10: 122,047,132 V21A probably benign Het
Trpa1 T C 1: 14,893,264 N578S possibly damaging Het
Xdh T C 17: 73,907,658 E764G probably damaging Het
Zfp518a G T 19: 40,915,310 V1228F probably damaging Het
Other mutations in Trim7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Trim7 APN 11 48845571 missense probably damaging 0.99
IGL00476:Trim7 APN 11 48848078 missense probably benign 0.39
R0119:Trim7 UTSW 11 48849712 missense probably damaging 1.00
R0308:Trim7 UTSW 11 48849501 missense probably damaging 0.96
R0546:Trim7 UTSW 11 48845509 missense probably damaging 1.00
R1067:Trim7 UTSW 11 48837819 missense probably damaging 0.99
R1081:Trim7 UTSW 11 48849705 missense probably damaging 1.00
R2139:Trim7 UTSW 11 48838894 missense probably benign 0.06
R3797:Trim7 UTSW 11 48845670 splice site probably null
R3901:Trim7 UTSW 11 48837608 missense probably damaging 0.98
R4157:Trim7 UTSW 11 48848093 missense probably benign 0.00
R4603:Trim7 UTSW 11 48837528 start codon destroyed probably null 0.98
R5429:Trim7 UTSW 11 48849955 missense probably damaging 1.00
R5915:Trim7 UTSW 11 48845650 missense possibly damaging 0.95
R5988:Trim7 UTSW 11 48837686 missense probably benign 0.01
R7960:Trim7 UTSW 11 48837801 missense probably damaging 0.99
R8100:Trim7 UTSW 11 48849519 missense probably damaging 1.00
Z1176:Trim7 UTSW 11 48849893 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCCGAGACAGAAGCAGATG -3'
(R):5'- AGAGACTTTGGACTCAAGTGTG -3'

Sequencing Primer
(F):5'- TAGGGGCGGAGTTCCAAGC -3'
(R):5'- ACTTTGGACTCAAGTGTGTGTAGAC -3'
Posted On2015-03-25