Incidental Mutation 'R3796:Clec14a'
ID272772
Institutional Source Beutler Lab
Gene Symbol Clec14a
Ensembl Gene ENSMUSG00000045930
Gene NameC-type lectin domain family 14, member a
Synonyms
MMRRC Submission 040757-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R3796 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location58264720-58269290 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 58267909 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 309 (A309V)
Ref Sequence ENSEMBL: ENSMUSP00000054451 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062254]
Predicted Effect probably benign
Transcript: ENSMUST00000062254
AA Change: A309V

PolyPhen 2 Score 0.335 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000054451
Gene: ENSMUSG00000045930
AA Change: A309V

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
CLECT 31 172 1.4e-5 SMART
EGF 246 288 1.85e0 SMART
transmembrane domain 388 410 N/A INTRINSIC
Meta Mutation Damage Score 0.0756 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the C-type lectin/C-type lectin-like domain (CTL/CTLD) superfamily. Members of this family share a common protein fold and have diverse functions, such as cell adhesion, cell-cell signalling, glycoprotein turnover, and roles in inflammation and immune response. This family member plays a role in cell-cell adhesion and angiogenesis. It functions in filopodia formation, cell migration and tube formation. Due to its presence at higher levels in tumor endothelium than in normal tissue endothelium, it is considered to be a candidate for tumor vascular targeting. [provided by RefSeq, Jan 2012]
PHENOTYPE: No notable pheontype was detected in a high-throughput screen of homozygous mutant mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130011E15Rik A G 19: 45,921,610 probably benign Het
Adamts17 A G 7: 66,839,914 probably null Het
Alpk3 C A 7: 81,092,753 P773T probably benign Het
Alppl2 A G 1: 87,088,354 probably null Het
Basp1 C A 15: 25,364,312 probably benign Het
Clk2 A G 3: 89,175,689 N424S probably benign Het
Cops7a C T 6: 124,959,832 R252H probably damaging Het
Csmd2 C T 4: 128,517,595 P2469S probably benign Het
Cwf19l1 A G 19: 44,114,567 V403A probably damaging Het
Dnajc16 G T 4: 141,767,737 D521E probably benign Het
Dnm2 T C 9: 21,505,487 V772A probably benign Het
Dst G T 1: 34,181,915 V2267F probably benign Het
Eif3d A G 15: 77,968,569 F4S probably damaging Het
Fgfr1 G A 8: 25,572,437 D663N probably damaging Het
Hmcn1 A G 1: 150,586,418 Y5170H probably damaging Het
Kcna2 T A 3: 107,105,590 L496I probably benign Het
Krt8 T C 15: 101,999,442 I233V probably benign Het
Mfap1b A G 2: 121,473,905 V3A probably benign Het
Phrf1 C T 7: 141,259,918 R243* probably null Het
Plbd2 A T 5: 120,492,868 I224N probably damaging Het
Rab19 T C 6: 39,384,041 V41A probably benign Het
Rrm1 T A 7: 102,465,703 probably null Het
Sacs T C 14: 61,206,121 V1872A possibly damaging Het
Setd2 T C 9: 110,549,571 V818A probably benign Het
Shprh C T 10: 11,178,757 L1037F possibly damaging Het
Slc24a3 A G 2: 145,616,681 D527G probably damaging Het
Slc27a6 T C 18: 58,598,751 probably benign Het
Slc35g3 A G 11: 69,760,917 F103L probably benign Het
Slc5a1 A G 5: 33,152,652 D408G probably damaging Het
Spag6l A T 16: 16,763,052 I477N probably damaging Het
Srgap1 A G 10: 122,047,132 V21A probably benign Het
Trim7 A G 11: 48,845,670 probably null Het
Trpa1 T C 1: 14,893,264 N578S possibly damaging Het
Xdh T C 17: 73,907,658 E764G probably damaging Het
Zfp518a G T 19: 40,915,310 V1228F probably damaging Het
Other mutations in Clec14a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01933:Clec14a APN 12 58268318 missense probably damaging 1.00
IGL02109:Clec14a APN 12 58268148 missense probably benign 0.00
IGL02121:Clec14a APN 12 58268437 missense probably damaging 1.00
IGL02136:Clec14a APN 12 58268629 missense probably damaging 1.00
IGL02818:Clec14a APN 12 58268102 missense probably damaging 1.00
R0379:Clec14a UTSW 12 58268794 missense possibly damaging 0.90
R0382:Clec14a UTSW 12 58268617 missense probably damaging 1.00
R0419:Clec14a UTSW 12 58267665 missense probably damaging 0.97
R2972:Clec14a UTSW 12 58267574 missense probably damaging 1.00
R3797:Clec14a UTSW 12 58267909 missense probably benign 0.34
R3876:Clec14a UTSW 12 58268644 missense possibly damaging 0.79
R4602:Clec14a UTSW 12 58267981 missense probably benign 0.03
R4708:Clec14a UTSW 12 58267703 missense probably benign 0.00
R4994:Clec14a UTSW 12 58268284 missense probably damaging 1.00
R5193:Clec14a UTSW 12 58268614 missense probably damaging 1.00
R5489:Clec14a UTSW 12 58268249 missense probably damaging 1.00
R5671:Clec14a UTSW 12 58267826 missense probably benign 0.05
R6318:Clec14a UTSW 12 58268215 missense probably damaging 1.00
R6388:Clec14a UTSW 12 58267457 makesense probably null
R6828:Clec14a UTSW 12 58268504 missense probably damaging 1.00
R7065:Clec14a UTSW 12 58268794 missense possibly damaging 0.90
R7418:Clec14a UTSW 12 58268647 missense probably damaging 0.99
R7635:Clec14a UTSW 12 58268528 missense probably damaging 1.00
R7666:Clec14a UTSW 12 58267757 missense probably benign 0.05
R7908:Clec14a UTSW 12 58267679 missense possibly damaging 0.63
X0024:Clec14a UTSW 12 58268326 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGTGTAGTTCAGGACCACGC -3'
(R):5'- CTGCATCCAGGAAGAGACAAGC -3'

Sequencing Primer
(F):5'- ACCACGCTTCCTGATGGTGTG -3'
(R):5'- ACACTGGGACGGGCTTTTC -3'
Posted On2015-03-25