Incidental Mutation 'R3796:Eif3d'
ID 272776
Institutional Source Beutler Lab
Gene Symbol Eif3d
Ensembl Gene ENSMUSG00000016554
Gene Name eukaryotic translation initiation factor 3, subunit D
Synonyms 66/67kDa, eIF3p66, mouse translation initiation factor eIF3 p66, Eif3s7
MMRRC Submission 040757-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.966) question?
Stock # R3796 (G1)
Quality Score 206
Status Validated
Chromosome 15
Chromosomal Location 77843201-77855006 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 77852769 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 4 (F4S)
Ref Sequence ENSEMBL: ENSMUSP00000155152 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100484] [ENSMUST00000230419]
AlphaFold O70194
Predicted Effect probably damaging
Transcript: ENSMUST00000100484
AA Change: F4S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000098053
Gene: ENSMUSG00000016554
AA Change: F4S

DomainStartEndE-ValueType
Pfam:eIF-3_zeta 4 521 6.3e-220 PFAM
low complexity region 530 547 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181255
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229413
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229713
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229737
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229784
Predicted Effect probably damaging
Transcript: ENSMUST00000230419
AA Change: F4S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230711
Meta Mutation Damage Score 0.9712 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Eukaryotic translation initiation factor-3 (eIF3), the largest of the eIFs, is a multiprotein complex composed of at least ten nonidentical subunits. The complex binds to the 40S ribosome and helps maintain the 40S and 60S ribosomal subunits in a dissociated state. It is also thought to play a role in the formation of the 40S initiation complex by interacting with the ternary complex of eIF2/GTP/methionyl-tRNA, and by promoting mRNA binding. The protein encoded by this gene is the major RNA binding subunit of the eIF3 complex. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts17 A G 7: 66,489,662 (GRCm39) probably null Het
Alpk3 C A 7: 80,742,501 (GRCm39) P773T probably benign Het
Alppl2 A G 1: 87,016,076 (GRCm39) probably null Het
Armh3 A G 19: 45,910,049 (GRCm39) probably benign Het
Basp1 C A 15: 25,364,398 (GRCm39) probably benign Het
Clec14a G A 12: 58,314,695 (GRCm39) A309V probably benign Het
Clk2 A G 3: 89,082,996 (GRCm39) N424S probably benign Het
Cops7a C T 6: 124,936,795 (GRCm39) R252H probably damaging Het
Csmd2 C T 4: 128,411,388 (GRCm39) P2469S probably benign Het
Cwf19l1 A G 19: 44,103,006 (GRCm39) V403A probably damaging Het
Dnajc16 G T 4: 141,495,048 (GRCm39) D521E probably benign Het
Dnm2 T C 9: 21,416,783 (GRCm39) V772A probably benign Het
Dst G T 1: 34,220,996 (GRCm39) V2267F probably benign Het
Fgfr1 G A 8: 26,062,453 (GRCm39) D663N probably damaging Het
Hmcn1 A G 1: 150,462,169 (GRCm39) Y5170H probably damaging Het
Kcna2 T A 3: 107,012,906 (GRCm39) L496I probably benign Het
Krt8 T C 15: 101,907,877 (GRCm39) I233V probably benign Het
Mfap1b A G 2: 121,304,386 (GRCm39) V3A probably benign Het
Phrf1 C T 7: 140,839,831 (GRCm39) R243* probably null Het
Plbd2 A T 5: 120,630,933 (GRCm39) I224N probably damaging Het
Rab19 T C 6: 39,360,975 (GRCm39) V41A probably benign Het
Rrm1 T A 7: 102,114,910 (GRCm39) probably null Het
Sacs T C 14: 61,443,570 (GRCm39) V1872A possibly damaging Het
Setd2 T C 9: 110,378,639 (GRCm39) V818A probably benign Het
Shprh C T 10: 11,054,501 (GRCm39) L1037F possibly damaging Het
Slc24a3 A G 2: 145,458,601 (GRCm39) D527G probably damaging Het
Slc27a6 T C 18: 58,731,823 (GRCm39) probably benign Het
Slc35g3 A G 11: 69,651,743 (GRCm39) F103L probably benign Het
Slc5a1 A G 5: 33,309,996 (GRCm39) D408G probably damaging Het
Spag6l A T 16: 16,580,916 (GRCm39) I477N probably damaging Het
Srgap1 A G 10: 121,883,037 (GRCm39) V21A probably benign Het
Trim7 A G 11: 48,736,497 (GRCm39) probably null Het
Trpa1 T C 1: 14,963,488 (GRCm39) N578S possibly damaging Het
Xdh T C 17: 74,214,653 (GRCm39) E764G probably damaging Het
Zfp518a G T 19: 40,903,754 (GRCm39) V1228F probably damaging Het
Other mutations in Eif3d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00840:Eif3d APN 15 77,846,069 (GRCm39) missense probably benign
IGL01082:Eif3d APN 15 77,843,943 (GRCm39) missense probably damaging 0.99
IGL01113:Eif3d APN 15 77,847,515 (GRCm39) missense probably damaging 1.00
IGL01865:Eif3d APN 15 77,851,546 (GRCm39) missense probably benign 0.34
IGL03070:Eif3d APN 15 77,843,843 (GRCm39) missense probably damaging 1.00
IGL03277:Eif3d APN 15 77,843,849 (GRCm39) missense possibly damaging 0.50
R0049:Eif3d UTSW 15 77,843,924 (GRCm39) missense probably benign 0.01
R0049:Eif3d UTSW 15 77,843,924 (GRCm39) missense probably benign 0.01
R0325:Eif3d UTSW 15 77,852,420 (GRCm39) missense probably damaging 1.00
R1346:Eif3d UTSW 15 77,852,754 (GRCm39) missense probably damaging 1.00
R2219:Eif3d UTSW 15 77,849,142 (GRCm39) missense probably benign 0.35
R2993:Eif3d UTSW 15 77,845,905 (GRCm39) missense possibly damaging 0.85
R3797:Eif3d UTSW 15 77,852,769 (GRCm39) missense probably damaging 1.00
R3839:Eif3d UTSW 15 77,848,300 (GRCm39) missense probably benign 0.30
R4690:Eif3d UTSW 15 77,851,516 (GRCm39) missense probably benign 0.06
R4828:Eif3d UTSW 15 77,844,229 (GRCm39) nonsense probably null
R5411:Eif3d UTSW 15 77,843,887 (GRCm39) missense probably damaging 1.00
R5558:Eif3d UTSW 15 77,846,047 (GRCm39) missense probably damaging 1.00
R6764:Eif3d UTSW 15 77,845,886 (GRCm39) missense probably damaging 1.00
R6821:Eif3d UTSW 15 77,845,855 (GRCm39) missense possibly damaging 0.93
R7176:Eif3d UTSW 15 77,847,434 (GRCm39) missense probably damaging 1.00
R7322:Eif3d UTSW 15 77,845,876 (GRCm39) missense probably benign 0.36
R7616:Eif3d UTSW 15 77,845,886 (GRCm39) missense probably damaging 1.00
R8199:Eif3d UTSW 15 77,844,292 (GRCm39) missense possibly damaging 0.66
R9457:Eif3d UTSW 15 77,843,894 (GRCm39) missense probably benign 0.00
R9553:Eif3d UTSW 15 77,843,837 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GTAGCCCCAAAGGAAGGATATC -3'
(R):5'- AAAATGTCGCTGGTGTTGGC -3'

Sequencing Primer
(F):5'- TATCCATCAAGAGACTAGAAAGGC -3'
(R):5'- CAGGGTTCTGCGTTTTGAGTGTTC -3'
Posted On 2015-03-25