Incidental Mutation 'R3796:Eif3d'
ID272776
Institutional Source Beutler Lab
Gene Symbol Eif3d
Ensembl Gene ENSMUSG00000016554
Gene Nameeukaryotic translation initiation factor 3, subunit D
SynonymsEif3s7, eIF3p66, 66/67kDa, mouse translation initiation factor eIF3 p66
MMRRC Submission 040757-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R3796 (G1)
Quality Score206
Status Validated
Chromosome15
Chromosomal Location77958998-77970813 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 77968569 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 4 (F4S)
Ref Sequence ENSEMBL: ENSMUSP00000155152 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100484] [ENSMUST00000230419]
Predicted Effect probably damaging
Transcript: ENSMUST00000100484
AA Change: F4S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000098053
Gene: ENSMUSG00000016554
AA Change: F4S

DomainStartEndE-ValueType
Pfam:eIF-3_zeta 4 521 6.3e-220 PFAM
low complexity region 530 547 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181255
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229413
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229713
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229737
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229784
Predicted Effect probably damaging
Transcript: ENSMUST00000230419
AA Change: F4S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230711
Meta Mutation Damage Score 0.9712 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Eukaryotic translation initiation factor-3 (eIF3), the largest of the eIFs, is a multiprotein complex composed of at least ten nonidentical subunits. The complex binds to the 40S ribosome and helps maintain the 40S and 60S ribosomal subunits in a dissociated state. It is also thought to play a role in the formation of the 40S initiation complex by interacting with the ternary complex of eIF2/GTP/methionyl-tRNA, and by promoting mRNA binding. The protein encoded by this gene is the major RNA binding subunit of the eIF3 complex. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130011E15Rik A G 19: 45,921,610 probably benign Het
Adamts17 A G 7: 66,839,914 probably null Het
Alpk3 C A 7: 81,092,753 P773T probably benign Het
Alppl2 A G 1: 87,088,354 probably null Het
Basp1 C A 15: 25,364,312 probably benign Het
Clec14a G A 12: 58,267,909 A309V probably benign Het
Clk2 A G 3: 89,175,689 N424S probably benign Het
Cops7a C T 6: 124,959,832 R252H probably damaging Het
Csmd2 C T 4: 128,517,595 P2469S probably benign Het
Cwf19l1 A G 19: 44,114,567 V403A probably damaging Het
Dnajc16 G T 4: 141,767,737 D521E probably benign Het
Dnm2 T C 9: 21,505,487 V772A probably benign Het
Dst G T 1: 34,181,915 V2267F probably benign Het
Fgfr1 G A 8: 25,572,437 D663N probably damaging Het
Hmcn1 A G 1: 150,586,418 Y5170H probably damaging Het
Kcna2 T A 3: 107,105,590 L496I probably benign Het
Krt8 T C 15: 101,999,442 I233V probably benign Het
Mfap1b A G 2: 121,473,905 V3A probably benign Het
Phrf1 C T 7: 141,259,918 R243* probably null Het
Plbd2 A T 5: 120,492,868 I224N probably damaging Het
Rab19 T C 6: 39,384,041 V41A probably benign Het
Rrm1 T A 7: 102,465,703 probably null Het
Sacs T C 14: 61,206,121 V1872A possibly damaging Het
Setd2 T C 9: 110,549,571 V818A probably benign Het
Shprh C T 10: 11,178,757 L1037F possibly damaging Het
Slc24a3 A G 2: 145,616,681 D527G probably damaging Het
Slc27a6 T C 18: 58,598,751 probably benign Het
Slc35g3 A G 11: 69,760,917 F103L probably benign Het
Slc5a1 A G 5: 33,152,652 D408G probably damaging Het
Spag6l A T 16: 16,763,052 I477N probably damaging Het
Srgap1 A G 10: 122,047,132 V21A probably benign Het
Trim7 A G 11: 48,845,670 probably null Het
Trpa1 T C 1: 14,893,264 N578S possibly damaging Het
Xdh T C 17: 73,907,658 E764G probably damaging Het
Zfp518a G T 19: 40,915,310 V1228F probably damaging Het
Other mutations in Eif3d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00840:Eif3d APN 15 77961869 missense probably benign
IGL01082:Eif3d APN 15 77959743 missense probably damaging 0.99
IGL01113:Eif3d APN 15 77963315 missense probably damaging 1.00
IGL01865:Eif3d APN 15 77967346 missense probably benign 0.34
IGL03070:Eif3d APN 15 77959643 missense probably damaging 1.00
IGL03277:Eif3d APN 15 77959649 missense possibly damaging 0.50
R0049:Eif3d UTSW 15 77959724 missense probably benign 0.01
R0049:Eif3d UTSW 15 77959724 missense probably benign 0.01
R0325:Eif3d UTSW 15 77968220 missense probably damaging 1.00
R1346:Eif3d UTSW 15 77968554 missense probably damaging 1.00
R2219:Eif3d UTSW 15 77964942 missense probably benign 0.35
R2993:Eif3d UTSW 15 77961705 missense possibly damaging 0.85
R3797:Eif3d UTSW 15 77968569 missense probably damaging 1.00
R3839:Eif3d UTSW 15 77964100 missense probably benign 0.30
R4690:Eif3d UTSW 15 77967316 missense probably benign 0.06
R4828:Eif3d UTSW 15 77960029 nonsense probably null
R5411:Eif3d UTSW 15 77959687 missense probably damaging 1.00
R5558:Eif3d UTSW 15 77961847 missense probably damaging 1.00
R6764:Eif3d UTSW 15 77961686 missense probably damaging 1.00
R6821:Eif3d UTSW 15 77961655 missense possibly damaging 0.93
R7176:Eif3d UTSW 15 77963234 missense probably damaging 1.00
R7322:Eif3d UTSW 15 77961676 missense probably benign 0.36
R7616:Eif3d UTSW 15 77961686 missense probably damaging 1.00
R8199:Eif3d UTSW 15 77960092 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- GTAGCCCCAAAGGAAGGATATC -3'
(R):5'- AAAATGTCGCTGGTGTTGGC -3'

Sequencing Primer
(F):5'- TATCCATCAAGAGACTAGAAAGGC -3'
(R):5'- CAGGGTTCTGCGTTTTGAGTGTTC -3'
Posted On2015-03-25