Mutagenetix > Incidental Mutation

Incidental Mutation 'R3796:Spag6l'

272778

Institutional Source

Beutler Lab

Gene Symbol

Spag6l

Ensembl Gene

ENSMUSG00000022783

Gene Name

sperm associated antigen 6-like

Synonyms

PF16, Spag6

MMRRC Submission

040757-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.348) question?

Stock #

R3796 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

16753016-16829456 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 16763052 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 477 (I477N)

Ref Sequence

ENSEMBL: ENSMUSP00000023468 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023468]

AlphaFold

Q9JLI7

Predicted Effect

probably damaging
Transcript: ENSMUST00000023468
AA Change: I477N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000023468
Gene: ENSMUSG00000022783
AA Change: I477N

Domain	Start	End	E-Value	Type
ARM	30	70	2.26e-3	SMART
Blast:ARM	72	112	3e-15	BLAST
ARM	114	154	3e-8	SMART
ARM	156	196	4.91e-4	SMART
ARM	198	238	1.03e-6	SMART
ARM	240	280	3.13e0	SMART
ARM	282	322	4.82e1	SMART
ARM	323	365	7.34e-3	SMART
Blast:ARM	367	409	7e-16	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154624

Meta Mutation Damage Score

0.8926

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.9%

Validation Efficiency

100% (40/40)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The correlation of anti-sperm antibodies with cases of unexplained infertility implicates a role for these antibodies in blocking fertilization. Improved diagnosis and treatment of immunologic infertility, as well as identification of proteins for targeted contraception, are dependent on the identification and characterization of relevant sperm antigens. The protein expressed by this gene is recognized by anti-sperm antibodies from an infertile man. This protein localizes to the tail of permeabilized human sperm and contains eight contiguous armadillo repeats, a motif known to mediate protein-protein interactions. Studies in mice suggest that this protein is involved in sperm flagellar motility and maintenance of the structural integrity of mature sperm. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Many homozygotes for a targeted null mutation exhibit reduced growth, hydrocephaly, and lethality by 8 weeks of age. Surviving males have sperm defects and are infertile, while females show reduced fertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 35 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9130011E15Rik	A	G	19: 45,921,610		probably benign	Het
Adamts17	A	G	7: 66,839,914		probably null	Het
Alpk3	C	A	7: 81,092,753	P773T	probably benign	Het
Alppl2	A	G	1: 87,088,354		probably null	Het
Basp1	C	A	15: 25,364,312		probably benign	Het
Clec14a	G	A	12: 58,267,909	A309V	probably benign	Het
Clk2	A	G	3: 89,175,689	N424S	probably benign	Het
Cops7a	C	T	6: 124,959,832	R252H	probably damaging	Het
Csmd2	C	T	4: 128,517,595	P2469S	probably benign	Het
Cwf19l1	A	G	19: 44,114,567	V403A	probably damaging	Het
Dnajc16	G	T	4: 141,767,737	D521E	probably benign	Het
Dnm2	T	C	9: 21,505,487	V772A	probably benign	Het
Dst	G	T	1: 34,181,915	V2267F	probably benign	Het
Eif3d	A	G	15: 77,968,569	F4S	probably damaging	Het
Fgfr1	G	A	8: 25,572,437	D663N	probably damaging	Het
Hmcn1	A	G	1: 150,586,418	Y5170H	probably damaging	Het
Kcna2	T	A	3: 107,105,590	L496I	probably benign	Het
Krt8	T	C	15: 101,999,442	I233V	probably benign	Het
Mfap1b	A	G	2: 121,473,905	V3A	probably benign	Het
Phrf1	C	T	7: 141,259,918	R243*	probably null	Het
Plbd2	A	T	5: 120,492,868	I224N	probably damaging	Het
Rab19	T	C	6: 39,384,041	V41A	probably benign	Het
Rrm1	T	A	7: 102,465,703		probably null	Het
Sacs	T	C	14: 61,206,121	V1872A	possibly damaging	Het
Setd2	T	C	9: 110,549,571	V818A	probably benign	Het
Shprh	C	T	10: 11,178,757	L1037F	possibly damaging	Het
Slc24a3	A	G	2: 145,616,681	D527G	probably damaging	Het
Slc27a6	T	C	18: 58,598,751		probably benign	Het
Slc35g3	A	G	11: 69,760,917	F103L	probably benign	Het
Slc5a1	A	G	5: 33,152,652	D408G	probably damaging	Het
Srgap1	A	G	10: 122,047,132	V21A	probably benign	Het
Trim7	A	G	11: 48,845,670		probably null	Het
Trpa1	T	C	1: 14,893,264	N578S	possibly damaging	Het
Xdh	T	C	17: 73,907,658	E764G	probably damaging	Het
Zfp518a	G	T	19: 40,915,310	V1228F	probably damaging	Het

Other mutations in Spag6l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00864:Spag6l	APN	16	16780733	missense	probably benign	0.20
IGL00928:Spag6l	APN	16	16767013	missense	possibly damaging	0.52
IGL00929:Spag6l	APN	16	16767013	missense	possibly damaging	0.52
IGL01793:Spag6l	APN	16	16781857	missense	probably damaging	1.00
IGL02380:Spag6l	APN	16	16763169	critical splice acceptor site	probably null
IGL03271:Spag6l	APN	16	16780728	missense	probably damaging	1.00
R0284:Spag6l	UTSW	16	16780766	missense	probably damaging	0.99
R0394:Spag6l	UTSW	16	16780629	missense	probably benign
R0720:Spag6l	UTSW	16	16767096	splice site	probably benign
R1205:Spag6l	UTSW	16	16787307	missense	probably damaging	1.00
R1496:Spag6l	UTSW	16	16780614	splice site	probably benign
R1707:Spag6l	UTSW	16	16780628	missense	probably benign	0.00
R1926:Spag6l	UTSW	16	16763057	missense	probably benign	0.00
R2255:Spag6l	UTSW	16	16777339	missense	probably damaging	0.96
R2330:Spag6l	UTSW	16	16829085	missense	probably benign
R3755:Spag6l	UTSW	16	16763020	critical splice donor site	probably null
R4093:Spag6l	UTSW	16	16829024	missense	probably benign	0.05
R4324:Spag6l	UTSW	16	16787235	missense	probably benign	0.00
R4725:Spag6l	UTSW	16	16792531	missense	probably damaging	1.00
R4766:Spag6l	UTSW	16	16777390	missense	probably benign	0.03
R4877:Spag6l	UTSW	16	16781758	missense	possibly damaging	0.47
R5753:Spag6l	UTSW	16	16766967	critical splice donor site	probably null
R5958:Spag6l	UTSW	16	16763021	critical splice donor site	probably null
R6107:Spag6l	UTSW	16	16781788	missense	possibly damaging	0.56
R6894:Spag6l	UTSW	16	16783938	missense	probably damaging	1.00
R7329:Spag6l	UTSW	16	16767019	missense	probably benign
R7634:Spag6l	UTSW	16	16777414	missense	probably damaging	0.97
R8240:Spag6l	UTSW	16	16763025	missense	probably damaging	1.00
R8464:Spag6l	UTSW	16	16763034	missense	probably damaging	0.97
R9207:Spag6l	UTSW	16	16780628	missense	probably benign	0.00
R9682:Spag6l	UTSW	16	16829117	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- AAGCTATACATTGGCCTCATGTAG -3'
(R):5'- TTCGGTAGTAAAACTCTAACTTGGG -3'

Sequencing Primer
(F):5'- GCTGCCTTCAGATCAAGATGTAG -3'
(R):5'- GAAAGAAGAAATGTTGTTTTGTGTGC -3'

Posted On

2015-03-25