Incidental Mutation 'R3796:Slc27a6'
ID 272780
Institutional Source Beutler Lab
Gene Symbol Slc27a6
Ensembl Gene ENSMUSG00000024600
Gene Name solute carrier family 27 (fatty acid transporter), member 6
Synonyms 4732438L20Rik, FATP6
MMRRC Submission 040757-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.060) question?
Stock # R3796 (G1)
Quality Score 225
Status Validated
Chromosome 18
Chromosomal Location 58556257-58612773 bp(+) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) T to C at 58598751 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000025500 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025500]
AlphaFold E9Q9W4
Predicted Effect probably benign
Transcript: ENSMUST00000025500
SMART Domains Protein: ENSMUSP00000025500
Gene: ENSMUSG00000024600

DomainStartEndE-ValueType
low complexity region 13 23 N/A INTRINSIC
Pfam:AMP-binding 60 487 5.3e-71 PFAM
Pfam:AMP-binding_C 495 571 2.6e-8 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the fatty acid transport protein family (FATP). FATPs are involved in the uptake of long-chain fatty acids and have unique expression patterns. Alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130011E15Rik A G 19: 45,921,610 probably benign Het
Adamts17 A G 7: 66,839,914 probably null Het
Alpk3 C A 7: 81,092,753 P773T probably benign Het
Alppl2 A G 1: 87,088,354 probably null Het
Basp1 C A 15: 25,364,312 probably benign Het
Clec14a G A 12: 58,267,909 A309V probably benign Het
Clk2 A G 3: 89,175,689 N424S probably benign Het
Cops7a C T 6: 124,959,832 R252H probably damaging Het
Csmd2 C T 4: 128,517,595 P2469S probably benign Het
Cwf19l1 A G 19: 44,114,567 V403A probably damaging Het
Dnajc16 G T 4: 141,767,737 D521E probably benign Het
Dnm2 T C 9: 21,505,487 V772A probably benign Het
Dst G T 1: 34,181,915 V2267F probably benign Het
Eif3d A G 15: 77,968,569 F4S probably damaging Het
Fgfr1 G A 8: 25,572,437 D663N probably damaging Het
Hmcn1 A G 1: 150,586,418 Y5170H probably damaging Het
Kcna2 T A 3: 107,105,590 L496I probably benign Het
Krt8 T C 15: 101,999,442 I233V probably benign Het
Mfap1b A G 2: 121,473,905 V3A probably benign Het
Phrf1 C T 7: 141,259,918 R243* probably null Het
Plbd2 A T 5: 120,492,868 I224N probably damaging Het
Rab19 T C 6: 39,384,041 V41A probably benign Het
Rrm1 T A 7: 102,465,703 probably null Het
Sacs T C 14: 61,206,121 V1872A possibly damaging Het
Setd2 T C 9: 110,549,571 V818A probably benign Het
Shprh C T 10: 11,178,757 L1037F possibly damaging Het
Slc24a3 A G 2: 145,616,681 D527G probably damaging Het
Slc35g3 A G 11: 69,760,917 F103L probably benign Het
Slc5a1 A G 5: 33,152,652 D408G probably damaging Het
Spag6l A T 16: 16,763,052 I477N probably damaging Het
Srgap1 A G 10: 122,047,132 V21A probably benign Het
Trim7 A G 11: 48,845,670 probably null Het
Trpa1 T C 1: 14,893,264 N578S possibly damaging Het
Xdh T C 17: 73,907,658 E764G probably damaging Het
Zfp518a G T 19: 40,915,310 V1228F probably damaging Het
Other mutations in Slc27a6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01103:Slc27a6 APN 18 58556764 missense probably benign
IGL01419:Slc27a6 APN 18 58609209 missense probably benign 0.00
IGL01638:Slc27a6 APN 18 58607813 missense probably damaging 1.00
IGL02067:Slc27a6 APN 18 58612191 missense probably benign 0.00
IGL02612:Slc27a6 APN 18 58556905 missense probably benign 0.00
IGL03118:Slc27a6 APN 18 58556743 missense probably benign 0.00
R0096:Slc27a6 UTSW 18 58598757 splice site probably benign
R0096:Slc27a6 UTSW 18 58598757 splice site probably benign
R0255:Slc27a6 UTSW 18 58609865 missense possibly damaging 0.69
R0449:Slc27a6 UTSW 18 58609165 splice site probably null
R0599:Slc27a6 UTSW 18 58556813 missense probably damaging 1.00
R0711:Slc27a6 UTSW 18 58598757 splice site probably benign
R1082:Slc27a6 UTSW 18 58556560 missense probably damaging 0.97
R1560:Slc27a6 UTSW 18 58579832 nonsense probably null
R1942:Slc27a6 UTSW 18 58556798 missense probably damaging 0.99
R2424:Slc27a6 UTSW 18 58605117 missense probably benign 0.20
R4718:Slc27a6 UTSW 18 58605066 missense probably benign 0.03
R4803:Slc27a6 UTSW 18 58572033 missense possibly damaging 0.59
R5714:Slc27a6 UTSW 18 58598553 missense probably damaging 0.97
R5773:Slc27a6 UTSW 18 58582173 missense probably damaging 1.00
R5996:Slc27a6 UTSW 18 58612234 missense possibly damaging 0.89
R6049:Slc27a6 UTSW 18 58598660 missense probably damaging 1.00
R6441:Slc27a6 UTSW 18 58572058 missense probably benign 0.06
R6701:Slc27a6 UTSW 18 58579875 missense probably benign 0.01
R6703:Slc27a6 UTSW 18 58609839 missense probably benign 0.19
R6809:Slc27a6 UTSW 18 58605054 missense probably benign 0.00
R7514:Slc27a6 UTSW 18 58612221 nonsense probably null
R7536:Slc27a6 UTSW 18 58556626 missense probably damaging 1.00
R7615:Slc27a6 UTSW 18 58609183 missense probably damaging 1.00
R7808:Slc27a6 UTSW 18 58609195 missense probably damaging 1.00
R8279:Slc27a6 UTSW 18 58572179 missense probably benign 0.00
R8842:Slc27a6 UTSW 18 58579816 missense probably benign 0.07
R8888:Slc27a6 UTSW 18 58582234 missense probably damaging 1.00
R8895:Slc27a6 UTSW 18 58582234 missense probably damaging 1.00
R9092:Slc27a6 UTSW 18 58609258 missense probably benign
R9103:Slc27a6 UTSW 18 58572196 missense probably damaging 0.99
R9153:Slc27a6 UTSW 18 58598733 missense probably benign 0.25
R9306:Slc27a6 UTSW 18 58609881 missense possibly damaging 0.50
R9620:Slc27a6 UTSW 18 58609815 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGTTGGAAACGGTTTGAGC -3'
(R):5'- ACCATGCAGTCAGTCATCC -3'

Sequencing Primer
(F):5'- AAACGGTTTGAGCAGTGATGTG -3'
(R):5'- TGCAGTCATCCCCATGCAG -3'
Posted On 2015-03-25