Incidental Mutation 'R3796:Zfp518a'
ID 272781
Institutional Source Beutler Lab
Gene Symbol Zfp518a
Ensembl Gene ENSMUSG00000049164
Gene Name zinc finger protein 518A
Synonyms 6330417C12Rik, 2810401C22Rik, Zfp518
MMRRC Submission 040757-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.924) question?
Stock # R3796 (G1)
Quality Score 225
Status Validated
Chromosome 19
Chromosomal Location 40894705-40917947 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 40915310 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Phenylalanine at position 1228 (V1228F)
Ref Sequence ENSEMBL: ENSMUSP00000055956 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050092]
AlphaFold B2RRF6
Predicted Effect probably damaging
Transcript: ENSMUST00000050092
AA Change: V1228F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000055956
Gene: ENSMUSG00000049164
AA Change: V1228F

DomainStartEndE-ValueType
ZnF_C2H2 121 146 1.38e2 SMART
ZnF_C2H2 152 174 4.98e-1 SMART
ZnF_C2H2 179 203 6.75e0 SMART
ZnF_C2H2 209 231 4.34e-1 SMART
ZnF_C2H2 236 258 1.33e-1 SMART
ZnF_C2H2 264 287 9.44e-2 SMART
low complexity region 308 319 N/A INTRINSIC
low complexity region 407 418 N/A INTRINSIC
low complexity region 544 563 N/A INTRINSIC
low complexity region 671 680 N/A INTRINSIC
low complexity region 814 825 N/A INTRINSIC
low complexity region 1147 1164 N/A INTRINSIC
low complexity region 1417 1424 N/A INTRINSIC
ZnF_C2H2 1444 1466 1.33e1 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the krueppel C2H2-type zinc finger protein family. The encoded protein contains five zinc fingers and is likely a nuclear transcriptional regulator. Numerous transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130011E15Rik A G 19: 45,921,610 probably benign Het
Adamts17 A G 7: 66,839,914 probably null Het
Alpk3 C A 7: 81,092,753 P773T probably benign Het
Alppl2 A G 1: 87,088,354 probably null Het
Basp1 C A 15: 25,364,312 probably benign Het
Clec14a G A 12: 58,267,909 A309V probably benign Het
Clk2 A G 3: 89,175,689 N424S probably benign Het
Cops7a C T 6: 124,959,832 R252H probably damaging Het
Csmd2 C T 4: 128,517,595 P2469S probably benign Het
Cwf19l1 A G 19: 44,114,567 V403A probably damaging Het
Dnajc16 G T 4: 141,767,737 D521E probably benign Het
Dnm2 T C 9: 21,505,487 V772A probably benign Het
Dst G T 1: 34,181,915 V2267F probably benign Het
Eif3d A G 15: 77,968,569 F4S probably damaging Het
Fgfr1 G A 8: 25,572,437 D663N probably damaging Het
Hmcn1 A G 1: 150,586,418 Y5170H probably damaging Het
Kcna2 T A 3: 107,105,590 L496I probably benign Het
Krt8 T C 15: 101,999,442 I233V probably benign Het
Mfap1b A G 2: 121,473,905 V3A probably benign Het
Phrf1 C T 7: 141,259,918 R243* probably null Het
Plbd2 A T 5: 120,492,868 I224N probably damaging Het
Rab19 T C 6: 39,384,041 V41A probably benign Het
Rrm1 T A 7: 102,465,703 probably null Het
Sacs T C 14: 61,206,121 V1872A possibly damaging Het
Setd2 T C 9: 110,549,571 V818A probably benign Het
Shprh C T 10: 11,178,757 L1037F possibly damaging Het
Slc24a3 A G 2: 145,616,681 D527G probably damaging Het
Slc27a6 T C 18: 58,598,751 probably benign Het
Slc35g3 A G 11: 69,760,917 F103L probably benign Het
Slc5a1 A G 5: 33,152,652 D408G probably damaging Het
Spag6l A T 16: 16,763,052 I477N probably damaging Het
Srgap1 A G 10: 122,047,132 V21A probably benign Het
Trim7 A G 11: 48,845,670 probably null Het
Trpa1 T C 1: 14,893,264 N578S possibly damaging Het
Xdh T C 17: 73,907,658 E764G probably damaging Het
Other mutations in Zfp518a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Zfp518a APN 19 40913470 missense probably damaging 0.99
IGL00647:Zfp518a APN 19 40914686 missense probably damaging 1.00
IGL01468:Zfp518a APN 19 40916031 missense probably benign 0.25
IGL02079:Zfp518a APN 19 40914617 missense probably damaging 1.00
IGL02080:Zfp518a APN 19 40914617 missense probably damaging 1.00
IGL02437:Zfp518a APN 19 40914617 missense probably damaging 1.00
IGL02466:Zfp518a APN 19 40914617 missense probably damaging 1.00
IGL02470:Zfp518a APN 19 40914617 missense probably damaging 1.00
IGL02471:Zfp518a APN 19 40914617 missense probably damaging 1.00
IGL02472:Zfp518a APN 19 40914617 missense probably damaging 1.00
IGL02500:Zfp518a APN 19 40914617 missense probably damaging 1.00
IGL02537:Zfp518a APN 19 40914617 missense probably damaging 1.00
IGL02537:Zfp518a APN 19 40915430 missense probably benign 0.05
IGL02546:Zfp518a APN 19 40914617 missense probably damaging 1.00
IGL02547:Zfp518a APN 19 40914617 missense probably damaging 1.00
IGL02561:Zfp518a APN 19 40914617 missense probably damaging 1.00
IGL02568:Zfp518a APN 19 40914617 missense probably damaging 1.00
IGL02583:Zfp518a APN 19 40914617 missense probably damaging 1.00
IGL02584:Zfp518a APN 19 40914617 missense probably damaging 1.00
IGL02586:Zfp518a APN 19 40914617 missense probably damaging 1.00
IGL02589:Zfp518a APN 19 40914617 missense probably damaging 1.00
IGL02614:Zfp518a APN 19 40914617 missense probably damaging 1.00
IGL02732:Zfp518a APN 19 40914617 missense probably damaging 1.00
IGL02961:Zfp518a APN 19 40915018 missense probably benign 0.44
IGL02985:Zfp518a APN 19 40913667 missense possibly damaging 0.92
R4630_zfp518a_157 UTSW 19 40912979 nonsense probably null
R0137:Zfp518a UTSW 19 40915866 missense probably damaging 1.00
R0218:Zfp518a UTSW 19 40912628 missense probably benign 0.25
R0367:Zfp518a UTSW 19 40912221 missense probably damaging 1.00
R0575:Zfp518a UTSW 19 40912315 missense probably damaging 1.00
R1418:Zfp518a UTSW 19 40914359 missense probably damaging 1.00
R1795:Zfp518a UTSW 19 40915556 missense probably benign 0.05
R1965:Zfp518a UTSW 19 40913510 missense probably benign 0.00
R2076:Zfp518a UTSW 19 40914327 missense probably damaging 1.00
R3799:Zfp518a UTSW 19 40915310 missense probably damaging 1.00
R3807:Zfp518a UTSW 19 40914797 missense possibly damaging 0.90
R3904:Zfp518a UTSW 19 40914920 nonsense probably null
R3959:Zfp518a UTSW 19 40912698 missense probably damaging 1.00
R4630:Zfp518a UTSW 19 40912979 nonsense probably null
R4662:Zfp518a UTSW 19 40911860 missense probably benign 0.01
R4844:Zfp518a UTSW 19 40914896 missense probably damaging 0.99
R4911:Zfp518a UTSW 19 40915528 missense probably benign 0.04
R4934:Zfp518a UTSW 19 40914263 missense probably benign 0.01
R4964:Zfp518a UTSW 19 40915851 missense possibly damaging 0.94
R4966:Zfp518a UTSW 19 40915851 missense possibly damaging 0.94
R5373:Zfp518a UTSW 19 40913510 missense probably benign 0.00
R5374:Zfp518a UTSW 19 40913510 missense probably benign 0.00
R5378:Zfp518a UTSW 19 40915856 missense probably damaging 1.00
R5509:Zfp518a UTSW 19 40915401 missense possibly damaging 0.60
R5891:Zfp518a UTSW 19 40912433 missense probably damaging 1.00
R6187:Zfp518a UTSW 19 40915446 missense probably benign 0.03
R6259:Zfp518a UTSW 19 40912781 missense probably benign 0.01
R6260:Zfp518a UTSW 19 40914123 missense probably benign 0.00
R6763:Zfp518a UTSW 19 40913748 missense probably damaging 1.00
R7419:Zfp518a UTSW 19 40913763 missense possibly damaging 0.94
R7448:Zfp518a UTSW 19 40914157 missense possibly damaging 0.70
R7719:Zfp518a UTSW 19 40912768 missense probably benign 0.01
R7753:Zfp518a UTSW 19 40915805 missense possibly damaging 0.47
R8181:Zfp518a UTSW 19 40913971 missense probably damaging 1.00
R8470:Zfp518a UTSW 19 40915718 missense probably benign 0.01
R8905:Zfp518a UTSW 19 40914336 missense probably damaging 1.00
R8911:Zfp518a UTSW 19 40913426 missense possibly damaging 0.87
R8912:Zfp518a UTSW 19 40913426 missense possibly damaging 0.87
R8917:Zfp518a UTSW 19 40913426 missense possibly damaging 0.87
R8918:Zfp518a UTSW 19 40913426 missense possibly damaging 0.87
R8968:Zfp518a UTSW 19 40913426 missense possibly damaging 0.87
R9029:Zfp518a UTSW 19 40912781 missense probably benign
R9335:Zfp518a UTSW 19 40912781 missense probably benign
R9336:Zfp518a UTSW 19 40912781 missense probably benign
R9581:Zfp518a UTSW 19 40911712 missense probably damaging 1.00
R9750:Zfp518a UTSW 19 40915445 missense possibly damaging 0.95
X0028:Zfp518a UTSW 19 40914933 missense possibly damaging 0.61
X0065:Zfp518a UTSW 19 40914182 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AACCAACTGTACATGGAGAGC -3'
(R):5'- TGGACATCTTCAGCACTAGCC -3'

Sequencing Primer
(F):5'- GCAGAAAGAGCCAGAAACTTC -3'
(R):5'- ATTCAATGTTGACTTTTTCCTTGGAG -3'
Posted On 2015-03-25