Incidental Mutation 'R3796:Cwf19l1'
ID 272782
Institutional Source Beutler Lab
Gene Symbol Cwf19l1
Ensembl Gene ENSMUSG00000025200
Gene Name CWF19-like 1, cell cycle control (S. pombe)
Synonyms 2610528C06Rik
MMRRC Submission 040757-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.799) question?
Stock # R3796 (G1)
Quality Score 225
Status Validated
Chromosome 19
Chromosomal Location 44108644-44135876 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 44114567 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 403 (V403A)
Ref Sequence ENSEMBL: ENSMUSP00000026218 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026218]
AlphaFold Q8CI33
Predicted Effect probably damaging
Transcript: ENSMUST00000026218
AA Change: V403A

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000026218
Gene: ENSMUSG00000025200
AA Change: V403A

DomainStartEndE-ValueType
Pfam:CwfJ_C_1 314 433 5.6e-37 PFAM
Pfam:CwfJ_C_2 439 534 2.1e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104203
Meta Mutation Damage Score 0.4750 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the CWF19 protein family. Mutations in this gene have been associated with autosomal recessive spinocerebellar ataxia-17 and mild mental retardation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130011E15Rik A G 19: 45,921,610 probably benign Het
Adamts17 A G 7: 66,839,914 probably null Het
Alpk3 C A 7: 81,092,753 P773T probably benign Het
Alppl2 A G 1: 87,088,354 probably null Het
Basp1 C A 15: 25,364,312 probably benign Het
Clec14a G A 12: 58,267,909 A309V probably benign Het
Clk2 A G 3: 89,175,689 N424S probably benign Het
Cops7a C T 6: 124,959,832 R252H probably damaging Het
Csmd2 C T 4: 128,517,595 P2469S probably benign Het
Dnajc16 G T 4: 141,767,737 D521E probably benign Het
Dnm2 T C 9: 21,505,487 V772A probably benign Het
Dst G T 1: 34,181,915 V2267F probably benign Het
Eif3d A G 15: 77,968,569 F4S probably damaging Het
Fgfr1 G A 8: 25,572,437 D663N probably damaging Het
Hmcn1 A G 1: 150,586,418 Y5170H probably damaging Het
Kcna2 T A 3: 107,105,590 L496I probably benign Het
Krt8 T C 15: 101,999,442 I233V probably benign Het
Mfap1b A G 2: 121,473,905 V3A probably benign Het
Phrf1 C T 7: 141,259,918 R243* probably null Het
Plbd2 A T 5: 120,492,868 I224N probably damaging Het
Rab19 T C 6: 39,384,041 V41A probably benign Het
Rrm1 T A 7: 102,465,703 probably null Het
Sacs T C 14: 61,206,121 V1872A possibly damaging Het
Setd2 T C 9: 110,549,571 V818A probably benign Het
Shprh C T 10: 11,178,757 L1037F possibly damaging Het
Slc24a3 A G 2: 145,616,681 D527G probably damaging Het
Slc27a6 T C 18: 58,598,751 probably benign Het
Slc35g3 A G 11: 69,760,917 F103L probably benign Het
Slc5a1 A G 5: 33,152,652 D408G probably damaging Het
Spag6l A T 16: 16,763,052 I477N probably damaging Het
Srgap1 A G 10: 122,047,132 V21A probably benign Het
Trim7 A G 11: 48,845,670 probably null Het
Trpa1 T C 1: 14,893,264 N578S possibly damaging Het
Xdh T C 17: 73,907,658 E764G probably damaging Het
Zfp518a G T 19: 40,915,310 V1228F probably damaging Het
Other mutations in Cwf19l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00923:Cwf19l1 APN 19 44131410 critical splice donor site probably null
IGL01691:Cwf19l1 APN 19 44120872 critical splice donor site probably null
IGL02427:Cwf19l1 APN 19 44133023 nonsense probably null
IGL03234:Cwf19l1 APN 19 44127370 missense probably damaging 1.00
IGL03236:Cwf19l1 APN 19 44127448 missense probably benign 0.00
IGL03275:Cwf19l1 APN 19 44123257 missense probably benign 0.10
R0068:Cwf19l1 UTSW 19 44131499 missense probably damaging 0.99
R0068:Cwf19l1 UTSW 19 44131499 missense probably damaging 0.99
R0486:Cwf19l1 UTSW 19 44114690 missense probably benign 0.35
R1820:Cwf19l1 UTSW 19 44127387 missense probably benign 0.00
R2317:Cwf19l1 UTSW 19 44132158 missense possibly damaging 0.92
R2418:Cwf19l1 UTSW 19 44131472 missense probably benign
R2438:Cwf19l1 UTSW 19 44110563 missense probably benign 0.00
R3850:Cwf19l1 UTSW 19 44131498 missense probably benign 0.24
R4518:Cwf19l1 UTSW 19 44133034 missense probably damaging 1.00
R4855:Cwf19l1 UTSW 19 44114567 missense probably damaging 0.97
R5402:Cwf19l1 UTSW 19 44133085 critical splice acceptor site probably null
R5587:Cwf19l1 UTSW 19 44120877 missense possibly damaging 0.49
R5785:Cwf19l1 UTSW 19 44121941 missense probably damaging 0.98
R6354:Cwf19l1 UTSW 19 44127473 missense probably benign 0.10
R6652:Cwf19l1 UTSW 19 44114699 missense probably benign 0.11
R7365:Cwf19l1 UTSW 19 44132140 missense probably damaging 1.00
R7548:Cwf19l1 UTSW 19 44110550 missense probably benign 0.18
R7562:Cwf19l1 UTSW 19 44129241 missense probably damaging 1.00
R9005:Cwf19l1 UTSW 19 44123214 missense possibly damaging 0.90
R9068:Cwf19l1 UTSW 19 44135835 unclassified probably benign
R9235:Cwf19l1 UTSW 19 44124836 missense probably damaging 1.00
R9695:Cwf19l1 UTSW 19 44112986 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCTCCCAGCCCTCTAAATG -3'
(R):5'- CATATAGGCTTGCTGTCTTGC -3'

Sequencing Primer
(F):5'- GCCCTCTAAATGACCACCATG -3'
(R):5'- CATATAGGCTTGCTGTCTTGCTTCTG -3'
Posted On 2015-03-25