Incidental Mutation 'R3797:Cdc73'
List |< first << previous [record 7 of 43] next >> last >|
ID272784
Institutional Source Beutler Lab
Gene Symbol Cdc73
Ensembl Gene ENSMUSG00000026361
Gene Namecell division cycle 73, Paf1/RNA polymerase II complex component
SynonymsHrpt2, 8430414L16Rik, C130030P16Rik
MMRRC Submission 040758-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3797 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location143598800-143702893 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 143677723 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 215 (D215E)
Ref Sequence ENSEMBL: ENSMUSP00000018337 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018337]
Predicted Effect probably benign
Transcript: ENSMUST00000018337
AA Change: D215E

PolyPhen 2 Score 0.216 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000018337
Gene: ENSMUSG00000026361
AA Change: D215E

DomainStartEndE-ValueType
Pfam:CDC73_N 1 297 3.4e-135 PFAM
Pfam:CDC73_C 356 521 2.6e-53 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212510
Meta Mutation Damage Score 0.1412 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tumor suppressor that is involved in transcriptional and post-transcriptional control pathways. The protein is a component of the the PAF protein complex, which associates with the RNA polymerase II subunit POLR2A and with a histone methyltransferase complex. This protein appears to facilitate the association of 3' mRNA processing factors with actively-transcribed chromatin. Mutations in this gene have been linked to hyperparathyroidism-jaw tumor syndrome, familial isolated hyperparathyroidism, and parathyroid carcinoma. [provided by RefSeq, Jul 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality around hatching or implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf3 T C 5: 30,196,823 I736V possibly damaging Het
Alpk3 C A 7: 81,092,753 P773T probably benign Het
B4galt1 G A 4: 40,807,258 T376I probably benign Het
Basp1 C A 15: 25,364,312 probably benign Het
Capn5 C T 7: 98,125,829 G535R probably null Het
Ccdc170 G A 10: 4,560,920 V660I possibly damaging Het
Clec14a G A 12: 58,267,909 A309V probably benign Het
Clns1a G A 7: 97,696,835 G36R probably benign Het
Cops7a C T 6: 124,959,832 R252H probably damaging Het
Csmd2 C T 4: 128,517,595 P2469S probably benign Het
Dsp T A 13: 38,177,284 probably null Het
Eif3d A G 15: 77,968,569 F4S probably damaging Het
Ephb1 T C 9: 101,971,267 T611A probably damaging Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Fgfr1 G A 8: 25,572,437 D663N probably damaging Het
Gm5592 G A 7: 41,157,835 probably benign Het
Itgb8 T C 12: 119,163,469 I683M possibly damaging Het
Kcnip3 A G 2: 127,482,014 S32P probably benign Het
Limch1 A G 5: 66,969,079 T8A probably damaging Het
Lmf1 G A 17: 25,654,471 V317M probably damaging Het
Ltbp1 A G 17: 75,362,630 Q1455R probably damaging Het
Marc2 T C 1: 184,841,308 E131G possibly damaging Het
Olfr620 C T 7: 103,611,447 R302Q probably benign Het
Pak7 T C 2: 136,100,826 I465V probably benign Het
Pcdhgb8 T C 18: 37,762,675 I266T probably benign Het
Pde4d T C 13: 109,632,897 S40P probably benign Het
Phrf1 C T 7: 141,259,918 R243* probably null Het
Polk A T 13: 96,486,982 probably benign Het
Ppl T C 16: 5,104,550 probably benign Het
Rab11fip3 A G 17: 26,068,526 C218R possibly damaging Het
Setd2 T C 9: 110,549,571 V818A probably benign Het
Skida1 C A 2: 18,045,897 E815* probably null Het
Slc35g3 A G 11: 69,760,917 F103L probably benign Het
Svil T A 18: 5,060,534 C802S probably benign Het
Trim7 A G 11: 48,845,670 probably null Het
Ugt3a1 G A 15: 9,310,641 W336* probably null Het
Vmn2r72 T C 7: 85,738,077 S760G probably benign Het
Vps13a T C 19: 16,745,947 probably null Het
Wdfy4 A T 14: 33,140,645 I590N probably damaging Het
Xdh T C 17: 73,907,658 E764G probably damaging Het
Xpnpep1 A T 19: 53,006,342 V285D probably benign Het
Zfp934 T C 13: 62,517,888 K313R probably benign Het
Other mutations in Cdc73
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01474:Cdc73 APN 1 143671332 missense probably benign 0.10
IGL01598:Cdc73 APN 1 143699279 missense probably damaging 1.00
R0648:Cdc73 UTSW 1 143695462 missense probably benign 0.00
R1299:Cdc73 UTSW 1 143699281 missense probably benign 0.00
R1342:Cdc73 UTSW 1 143702492 critical splice donor site probably null
R1411:Cdc73 UTSW 1 143609514 splice site probably benign
R1837:Cdc73 UTSW 1 143667657 missense possibly damaging 0.46
R2208:Cdc73 UTSW 1 143609382 missense probably damaging 1.00
R3721:Cdc73 UTSW 1 143695453 missense possibly damaging 0.77
R4088:Cdc73 UTSW 1 143608514 utr 3 prime probably benign
R4603:Cdc73 UTSW 1 143677857 critical splice acceptor site probably null
R4782:Cdc73 UTSW 1 143627875 missense probably benign 0.10
R4799:Cdc73 UTSW 1 143627875 missense probably benign 0.10
R5512:Cdc73 UTSW 1 143702616 missense probably damaging 1.00
R5801:Cdc73 UTSW 1 143608543 missense probably benign 0.01
R6006:Cdc73 UTSW 1 143617439 missense probably damaging 1.00
R6258:Cdc73 UTSW 1 143691473 missense probably benign 0.32
R6260:Cdc73 UTSW 1 143691473 missense probably benign 0.32
R6744:Cdc73 UTSW 1 143702149 intron probably benign
Predicted Primers PCR Primer
(F):5'- ACCTTCACACAGTTTGAATAAGCC -3'
(R):5'- TTGTACTGAAAGAATCTTGGCTGTG -3'

Sequencing Primer
(F):5'- TGAATAAGCCTCAAATTGACAGACTC -3'
(R):5'- GAAGCCATGTCAGTGGAA -3'
Posted On2015-03-25