Incidental Mutation 'R3797:Marc2'
List |< first << previous [record 23 of 43] next >> last >|
ID272785
Institutional Source Beutler Lab
Gene Symbol Marc2
Ensembl Gene ENSMUSG00000073481
Gene Namemitochondrial amidoxime reducing component 2
Synonyms
MMRRC Submission 040758-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R3797 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location184813068-184846451 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 184841308 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 131 (E131G)
Ref Sequence ENSEMBL: ENSMUSP00000066715 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068725] [ENSMUST00000161821]
Predicted Effect possibly damaging
Transcript: ENSMUST00000068725
AA Change: E131G

PolyPhen 2 Score 0.792 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000066715
Gene: ENSMUSG00000073481
AA Change: E131G

DomainStartEndE-ValueType
transmembrane domain 20 39 N/A INTRINSIC
low complexity region 41 49 N/A INTRINSIC
Pfam:MOSC_N 54 175 4.6e-41 PFAM
Pfam:MOSC 200 334 1.9e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159293
SMART Domains Protein: ENSMUSP00000124809
Gene: ENSMUSG00000073481

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
low complexity region 38 46 N/A INTRINSIC
Pfam:MOSC_N 51 172 1.8e-41 PFAM
Pfam:MOSC 184 256 2.5e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160982
Predicted Effect probably benign
Transcript: ENSMUST00000161821
AA Change: E38G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000125374
Gene: ENSMUSG00000073481
AA Change: E38G

DomainStartEndE-ValueType
Pfam:MOSC_N 1 82 9e-24 PFAM
Pfam:MOSC 94 190 2.4e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162501
SMART Domains Protein: ENSMUSP00000125039
Gene: ENSMUSG00000073481

DomainStartEndE-ValueType
Pfam:MOSC_N 1 93 5.9e-29 PFAM
Pfam:MOSC 105 173 1.4e-19 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an enzyme found in the outer mitochondrial membrane that reduces N-hydroxylated substrates. The encoded protein uses molybdenum as a cofactor and cytochrome b5 type B and NADH cytochrome b5 reductase as accessory proteins. One type of substrate used is N-hydroxylated nucleotide base analogues, which can be toxic to a cell. Other substrates include N(omega)-hydroxy-L-arginine (NOHA) and amidoxime prodrugs, which are activated by the encoded enzyme. Multiple transcript variants encoding the different isoforms have been found for this gene. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf3 T C 5: 30,196,823 I736V possibly damaging Het
Alpk3 C A 7: 81,092,753 P773T probably benign Het
B4galt1 G A 4: 40,807,258 T376I probably benign Het
Basp1 C A 15: 25,364,312 probably benign Het
Capn5 C T 7: 98,125,829 G535R probably null Het
Ccdc170 G A 10: 4,560,920 V660I possibly damaging Het
Cdc73 A T 1: 143,677,723 D215E probably benign Het
Clec14a G A 12: 58,267,909 A309V probably benign Het
Clns1a G A 7: 97,696,835 G36R probably benign Het
Cops7a C T 6: 124,959,832 R252H probably damaging Het
Csmd2 C T 4: 128,517,595 P2469S probably benign Het
Dsp T A 13: 38,177,284 probably null Het
Eif3d A G 15: 77,968,569 F4S probably damaging Het
Ephb1 T C 9: 101,971,267 T611A probably damaging Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Fgfr1 G A 8: 25,572,437 D663N probably damaging Het
Gm5592 G A 7: 41,157,835 probably benign Het
Itgb8 T C 12: 119,163,469 I683M possibly damaging Het
Kcnip3 A G 2: 127,482,014 S32P probably benign Het
Limch1 A G 5: 66,969,079 T8A probably damaging Het
Lmf1 G A 17: 25,654,471 V317M probably damaging Het
Ltbp1 A G 17: 75,362,630 Q1455R probably damaging Het
Olfr620 C T 7: 103,611,447 R302Q probably benign Het
Pak7 T C 2: 136,100,826 I465V probably benign Het
Pcdhgb8 T C 18: 37,762,675 I266T probably benign Het
Pde4d T C 13: 109,632,897 S40P probably benign Het
Phrf1 C T 7: 141,259,918 R243* probably null Het
Polk A T 13: 96,486,982 probably benign Het
Ppl T C 16: 5,104,550 probably benign Het
Rab11fip3 A G 17: 26,068,526 C218R possibly damaging Het
Setd2 T C 9: 110,549,571 V818A probably benign Het
Skida1 C A 2: 18,045,897 E815* probably null Het
Slc35g3 A G 11: 69,760,917 F103L probably benign Het
Svil T A 18: 5,060,534 C802S probably benign Het
Trim7 A G 11: 48,845,670 probably null Het
Ugt3a1 G A 15: 9,310,641 W336* probably null Het
Vmn2r72 T C 7: 85,738,077 S760G probably benign Het
Vps13a T C 19: 16,745,947 probably null Het
Wdfy4 A T 14: 33,140,645 I590N probably damaging Het
Xdh T C 17: 73,907,658 E764G probably damaging Het
Xpnpep1 A T 19: 53,006,342 V285D probably benign Het
Zfp934 T C 13: 62,517,888 K313R probably benign Het
Other mutations in Marc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01010:Marc2 APN 1 184819316 missense probably benign 0.00
IGL01326:Marc2 APN 1 184833851 splice site probably benign
IGL01386:Marc2 APN 1 184819216 unclassified probably benign
IGL01636:Marc2 APN 1 184832641 missense probably benign 0.25
LCD18:Marc2 UTSW 1 184822788 intron probably benign
R0594:Marc2 UTSW 1 184841339 missense probably benign 0.00
R1340:Marc2 UTSW 1 184822547 missense probably benign 0.05
R4899:Marc2 UTSW 1 184845624 missense probably damaging 1.00
R4960:Marc2 UTSW 1 184833919 missense probably benign 0.00
R5734:Marc2 UTSW 1 184832589 missense probably benign 0.01
R6266:Marc2 UTSW 1 184833943 missense probably damaging 1.00
R6331:Marc2 UTSW 1 184819328 missense probably damaging 0.98
R6550:Marc2 UTSW 1 184819342 missense probably damaging 1.00
R6986:Marc2 UTSW 1 184841263 missense probably benign
R7569:Marc2 UTSW 1 184841425 missense possibly damaging 0.66
R7610:Marc2 UTSW 1 184819286 missense probably benign 0.11
R8152:Marc2 UTSW 1 184841312 missense possibly damaging 0.90
R8363:Marc2 UTSW 1 184833858 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AACTCAAAGCTAGTCCTGGGTAC -3'
(R):5'- TCCTTGGGAAATGAGGAAGCTG -3'

Sequencing Primer
(F):5'- GGTACCCTTAACAGTCGCTCAC -3'
(R):5'- AAGCTGTTCTGAGTGTGCCC -3'
Posted On2015-03-25