Incidental Mutation 'R3797:Skida1'
ID272786
Institutional Source Beutler Lab
Gene Symbol Skida1
Ensembl Gene ENSMUSG00000054074
Gene NameSKI/DACH domain containing 1
Synonyms
MMRRC Submission 040758-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.117) question?
Stock #R3797 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location18040676-18049051 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 18045897 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 815 (E815*)
Ref Sequence ENSEMBL: ENSMUSP00000088982 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066885] [ENSMUST00000091420] [ENSMUST00000142856] [ENSMUST00000152908]
Predicted Effect probably null
Transcript: ENSMUST00000066885
AA Change: E728*
SMART Domains Protein: ENSMUSP00000068520
Gene: ENSMUSG00000054074
AA Change: E728*

DomainStartEndE-ValueType
Pfam:Ski_Sno 5 98 4.1e-19 PFAM
low complexity region 116 130 N/A INTRINSIC
low complexity region 152 167 N/A INTRINSIC
low complexity region 262 279 N/A INTRINSIC
low complexity region 282 297 N/A INTRINSIC
coiled coil region 315 337 N/A INTRINSIC
Pfam:DUF4584 383 820 9.7e-162 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000091420
AA Change: E815*
SMART Domains Protein: ENSMUSP00000088982
Gene: ENSMUSG00000054074
AA Change: E815*

DomainStartEndE-ValueType
Pfam:Ski_Sno 5 97 7.7e-17 PFAM
low complexity region 116 130 N/A INTRINSIC
low complexity region 152 167 N/A INTRINSIC
SCOP:d1gkub1 224 254 3e-3 SMART
SCOP:d1gkub1 296 321 6e-3 SMART
low complexity region 349 366 N/A INTRINSIC
low complexity region 369 384 N/A INTRINSIC
coiled coil region 402 424 N/A INTRINSIC
Pfam:DUF4584 471 907 7.7e-179 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142856
SMART Domains Protein: ENSMUSP00000122112
Gene: ENSMUSG00000054074

DomainStartEndE-ValueType
Pfam:Ski_Sno 5 98 4.4e-20 PFAM
low complexity region 116 130 N/A INTRINSIC
low complexity region 152 167 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152908
SMART Domains Protein: ENSMUSP00000114785
Gene: ENSMUSG00000054074

DomainStartEndE-ValueType
Pfam:Ski_Sno 5 65 2.8e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173604
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (39/39)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf3 T C 5: 30,196,823 I736V possibly damaging Het
Alpk3 C A 7: 81,092,753 P773T probably benign Het
B4galt1 G A 4: 40,807,258 T376I probably benign Het
Basp1 C A 15: 25,364,312 probably benign Het
Capn5 C T 7: 98,125,829 G535R probably null Het
Ccdc170 G A 10: 4,560,920 V660I possibly damaging Het
Cdc73 A T 1: 143,677,723 D215E probably benign Het
Clec14a G A 12: 58,267,909 A309V probably benign Het
Clns1a G A 7: 97,696,835 G36R probably benign Het
Cops7a C T 6: 124,959,832 R252H probably damaging Het
Csmd2 C T 4: 128,517,595 P2469S probably benign Het
Dsp T A 13: 38,177,284 probably null Het
Eif3d A G 15: 77,968,569 F4S probably damaging Het
Ephb1 T C 9: 101,971,267 T611A probably damaging Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Fgfr1 G A 8: 25,572,437 D663N probably damaging Het
Gm5592 G A 7: 41,157,835 probably benign Het
Itgb8 T C 12: 119,163,469 I683M possibly damaging Het
Kcnip3 A G 2: 127,482,014 S32P probably benign Het
Limch1 A G 5: 66,969,079 T8A probably damaging Het
Lmf1 G A 17: 25,654,471 V317M probably damaging Het
Ltbp1 A G 17: 75,362,630 Q1455R probably damaging Het
Marc2 T C 1: 184,841,308 E131G possibly damaging Het
Olfr620 C T 7: 103,611,447 R302Q probably benign Het
Pak7 T C 2: 136,100,826 I465V probably benign Het
Pcdhgb8 T C 18: 37,762,675 I266T probably benign Het
Pde4d T C 13: 109,632,897 S40P probably benign Het
Phrf1 C T 7: 141,259,918 R243* probably null Het
Polk A T 13: 96,486,982 probably benign Het
Ppl T C 16: 5,104,550 probably benign Het
Rab11fip3 A G 17: 26,068,526 C218R possibly damaging Het
Setd2 T C 9: 110,549,571 V818A probably benign Het
Slc35g3 A G 11: 69,760,917 F103L probably benign Het
Svil T A 18: 5,060,534 C802S probably benign Het
Trim7 A G 11: 48,845,670 probably null Het
Ugt3a1 G A 15: 9,310,641 W336* probably null Het
Vmn2r72 T C 7: 85,738,077 S760G probably benign Het
Vps13a T C 19: 16,745,947 probably null Het
Wdfy4 A T 14: 33,140,645 I590N probably damaging Het
Xdh T C 17: 73,907,658 E764G probably damaging Het
Xpnpep1 A T 19: 53,006,342 V285D probably benign Het
Zfp934 T C 13: 62,517,888 K313R probably benign Het
Other mutations in Skida1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02315:Skida1 APN 2 18046005 unclassified probably benign
IGL03220:Skida1 APN 2 18048161 missense probably damaging 1.00
R0328:Skida1 UTSW 2 18047186 unclassified probably benign
R0732:Skida1 UTSW 2 18046157 unclassified probably benign
R1239:Skida1 UTSW 2 18047317 unclassified probably benign
R1346:Skida1 UTSW 2 18048279 missense possibly damaging 0.92
R1597:Skida1 UTSW 2 18046332 unclassified probably benign
R1867:Skida1 UTSW 2 18046344 unclassified probably benign
R4521:Skida1 UTSW 2 18045872 unclassified probably benign
R5270:Skida1 UTSW 2 18047649 missense probably benign 0.03
R5467:Skida1 UTSW 2 18046112 unclassified probably benign
R5890:Skida1 UTSW 2 18046003 unclassified probably benign
R7181:Skida1 UTSW 2 18046791 missense unknown
R7398:Skida1 UTSW 2 18046272 missense unknown
R8103:Skida1 UTSW 2 18047738 missense probably benign 0.01
R8199:Skida1 UTSW 2 18048148 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTGTTTAAGGAATACGCTGGC -3'
(R):5'- ATGCCCTGAGAAAGAAACGC -3'

Sequencing Primer
(F):5'- TTTAAGGAATACGCTGGCCACAAATC -3'
(R):5'- TTAAATCCACTGGCTCAGAGTC -3'
Posted On2015-03-25