Incidental Mutation 'R3797:Cops7a'
ID272792
Institutional Source Beutler Lab
Gene Symbol Cops7a
Ensembl Gene ENSMUSG00000030127
Gene NameCOP9 signalosome subunit 7A
SynonymsCOP9 complex S7a, D6Ertd35e
MMRRC Submission 040758-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3797 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location124958413-124965538 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 124959832 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 252 (R252H)
Ref Sequence ENSEMBL: ENSMUSP00000108058 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032220] [ENSMUST00000112439] [ENSMUST00000129446] [ENSMUST00000129976] [ENSMUST00000148485]
Predicted Effect probably damaging
Transcript: ENSMUST00000032220
AA Change: R252H

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000032220
Gene: ENSMUSG00000030127
AA Change: R252H

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
PINT 87 177 2.65e-18 SMART
coiled coil region 197 230 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083831
Predicted Effect probably damaging
Transcript: ENSMUST00000112439
AA Change: R252H

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000108058
Gene: ENSMUSG00000030127
AA Change: R252H

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
PINT 87 177 2.65e-18 SMART
coiled coil region 197 230 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129446
SMART Domains Protein: ENSMUSP00000114420
Gene: ENSMUSG00000030127

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
PINT 87 176 2e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129976
SMART Domains Protein: ENSMUSP00000117584
Gene: ENSMUSG00000030127

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
PINT 87 177 2.65e-18 SMART
coiled coil region 197 222 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135645
Predicted Effect probably benign
Transcript: ENSMUST00000148485
SMART Domains Protein: ENSMUSP00000115348
Gene: ENSMUSG00000030127

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
Blast:PINT 31 77 2e-7 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149346
Meta Mutation Damage Score 0.1205 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the COP9 signalosome, an evolutionarily conserved multi-subunit protease that regulates the activity of the ubiquitin conjugation pathway. Alternatively spliced transcript variants that encode the same protein have been described. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf3 T C 5: 30,196,823 I736V possibly damaging Het
Alpk3 C A 7: 81,092,753 P773T probably benign Het
B4galt1 G A 4: 40,807,258 T376I probably benign Het
Basp1 C A 15: 25,364,312 probably benign Het
Capn5 C T 7: 98,125,829 G535R probably null Het
Ccdc170 G A 10: 4,560,920 V660I possibly damaging Het
Cdc73 A T 1: 143,677,723 D215E probably benign Het
Clec14a G A 12: 58,267,909 A309V probably benign Het
Clns1a G A 7: 97,696,835 G36R probably benign Het
Csmd2 C T 4: 128,517,595 P2469S probably benign Het
Dsp T A 13: 38,177,284 probably null Het
Eif3d A G 15: 77,968,569 F4S probably damaging Het
Ephb1 T C 9: 101,971,267 T611A probably damaging Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Fgfr1 G A 8: 25,572,437 D663N probably damaging Het
Gm5592 G A 7: 41,157,835 probably benign Het
Itgb8 T C 12: 119,163,469 I683M possibly damaging Het
Kcnip3 A G 2: 127,482,014 S32P probably benign Het
Limch1 A G 5: 66,969,079 T8A probably damaging Het
Lmf1 G A 17: 25,654,471 V317M probably damaging Het
Ltbp1 A G 17: 75,362,630 Q1455R probably damaging Het
Marc2 T C 1: 184,841,308 E131G possibly damaging Het
Olfr620 C T 7: 103,611,447 R302Q probably benign Het
Pak7 T C 2: 136,100,826 I465V probably benign Het
Pcdhgb8 T C 18: 37,762,675 I266T probably benign Het
Pde4d T C 13: 109,632,897 S40P probably benign Het
Phrf1 C T 7: 141,259,918 R243* probably null Het
Polk A T 13: 96,486,982 probably benign Het
Ppl T C 16: 5,104,550 probably benign Het
Rab11fip3 A G 17: 26,068,526 C218R possibly damaging Het
Setd2 T C 9: 110,549,571 V818A probably benign Het
Skida1 C A 2: 18,045,897 E815* probably null Het
Slc35g3 A G 11: 69,760,917 F103L probably benign Het
Svil T A 18: 5,060,534 C802S probably benign Het
Trim7 A G 11: 48,845,670 probably null Het
Ugt3a1 G A 15: 9,310,641 W336* probably null Het
Vmn2r72 T C 7: 85,738,077 S760G probably benign Het
Vps13a T C 19: 16,745,947 probably null Het
Wdfy4 A T 14: 33,140,645 I590N probably damaging Het
Xdh T C 17: 73,907,658 E764G probably damaging Het
Xpnpep1 A T 19: 53,006,342 V285D probably benign Het
Zfp934 T C 13: 62,517,888 K313R probably benign Het
Other mutations in Cops7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01936:Cops7a APN 6 124962416 missense probably benign 0.00
rubric UTSW 6 124960176 missense probably damaging 1.00
H8562:Cops7a UTSW 6 124962453 unclassified probably benign
R0139:Cops7a UTSW 6 124961360 missense probably damaging 0.98
R0242:Cops7a UTSW 6 124964854 missense probably benign 0.00
R0242:Cops7a UTSW 6 124964854 missense probably benign 0.00
R1121:Cops7a UTSW 6 124962416 missense probably benign 0.00
R1662:Cops7a UTSW 6 124962438 missense probably damaging 0.96
R1935:Cops7a UTSW 6 124962396 nonsense probably null
R2920:Cops7a UTSW 6 124962362 missense probably benign 0.21
R3796:Cops7a UTSW 6 124959832 missense probably damaging 1.00
R3799:Cops7a UTSW 6 124959832 missense probably damaging 1.00
R3854:Cops7a UTSW 6 124959832 missense probably damaging 1.00
R5034:Cops7a UTSW 6 124962620 unclassified probably null
R5858:Cops7a UTSW 6 124960171 missense possibly damaging 0.82
R6477:Cops7a UTSW 6 124960176 missense probably damaging 1.00
R6879:Cops7a UTSW 6 124958785 splice site probably null
Predicted Primers PCR Primer
(F):5'- TCAGTTCGACTTGGACCAAATCTTG -3'
(R):5'- TAAAATCATCAGGGCCCGTCC -3'

Sequencing Primer
(F):5'- AAATCTTGGCGCTCCCTCGG -3'
(R):5'- CCGTCCGGTTCCAGAAC -3'
Posted On2015-03-25