Incidental Mutation 'R3797:Capn5'
List |< first << previous [record 5 of 43] next >> last >|
ID272797
Institutional Source Beutler Lab
Gene Symbol Capn5
Ensembl Gene ENSMUSG00000035547
Gene Namecalpain 5
Synonyms
MMRRC Submission 040758-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.137) question?
Stock #R3797 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location98121559-98178274 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 98125829 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 535 (G535R)
Ref Sequence ENSEMBL: ENSMUSP00000102729 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040971] [ENSMUST00000107112]
Predicted Effect probably null
Transcript: ENSMUST00000040971
AA Change: G535R

PolyPhen 2 Score 0.770 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000048183
Gene: ENSMUSG00000035547
AA Change: G535R

DomainStartEndE-ValueType
CysPc 8 351 4.18e-212 SMART
calpain_III 353 496 1.21e-66 SMART
C2 518 619 1.29e-9 SMART
Predicted Effect probably null
Transcript: ENSMUST00000107112
AA Change: G535R

PolyPhen 2 Score 0.770 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000102729
Gene: ENSMUSG00000035547
AA Change: G535R

DomainStartEndE-ValueType
CysPc 8 351 4.18e-212 SMART
calpain_III 353 496 1.21e-66 SMART
C2 518 619 1.29e-9 SMART
Meta Mutation Damage Score 0.3586 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the calpain family of proteins. Unlike many members of the calpain gene family, this gene lacks a calmodulin-like domain, required for calcium binding. Mouse models for Huntington's disease displayed increased levels of the protein encoded by this gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for one allele of this gene occasionally exhibit reduced viability but are usually normal. Homozygotes for another allele die as embryos. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf3 T C 5: 30,196,823 I736V possibly damaging Het
Alpk3 C A 7: 81,092,753 P773T probably benign Het
B4galt1 G A 4: 40,807,258 T376I probably benign Het
Basp1 C A 15: 25,364,312 probably benign Het
Ccdc170 G A 10: 4,560,920 V660I possibly damaging Het
Cdc73 A T 1: 143,677,723 D215E probably benign Het
Clec14a G A 12: 58,267,909 A309V probably benign Het
Clns1a G A 7: 97,696,835 G36R probably benign Het
Cops7a C T 6: 124,959,832 R252H probably damaging Het
Csmd2 C T 4: 128,517,595 P2469S probably benign Het
Dsp T A 13: 38,177,284 probably null Het
Eif3d A G 15: 77,968,569 F4S probably damaging Het
Ephb1 T C 9: 101,971,267 T611A probably damaging Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Fgfr1 G A 8: 25,572,437 D663N probably damaging Het
Gm5592 G A 7: 41,157,835 probably benign Het
Itgb8 T C 12: 119,163,469 I683M possibly damaging Het
Kcnip3 A G 2: 127,482,014 S32P probably benign Het
Limch1 A G 5: 66,969,079 T8A probably damaging Het
Lmf1 G A 17: 25,654,471 V317M probably damaging Het
Ltbp1 A G 17: 75,362,630 Q1455R probably damaging Het
Marc2 T C 1: 184,841,308 E131G possibly damaging Het
Olfr620 C T 7: 103,611,447 R302Q probably benign Het
Pak7 T C 2: 136,100,826 I465V probably benign Het
Pcdhgb8 T C 18: 37,762,675 I266T probably benign Het
Pde4d T C 13: 109,632,897 S40P probably benign Het
Phrf1 C T 7: 141,259,918 R243* probably null Het
Polk A T 13: 96,486,982 probably benign Het
Ppl T C 16: 5,104,550 probably benign Het
Rab11fip3 A G 17: 26,068,526 C218R possibly damaging Het
Setd2 T C 9: 110,549,571 V818A probably benign Het
Skida1 C A 2: 18,045,897 E815* probably null Het
Slc35g3 A G 11: 69,760,917 F103L probably benign Het
Svil T A 18: 5,060,534 C802S probably benign Het
Trim7 A G 11: 48,845,670 probably null Het
Ugt3a1 G A 15: 9,310,641 W336* probably null Het
Vmn2r72 T C 7: 85,738,077 S760G probably benign Het
Vps13a T C 19: 16,745,947 probably null Het
Wdfy4 A T 14: 33,140,645 I590N probably damaging Het
Xdh T C 17: 73,907,658 E764G probably damaging Het
Xpnpep1 A T 19: 53,006,342 V285D probably benign Het
Zfp934 T C 13: 62,517,888 K313R probably benign Het
Other mutations in Capn5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01019:Capn5 APN 7 98135764 missense probably damaging 1.00
IGL01311:Capn5 APN 7 98161923 missense probably damaging 1.00
IGL01768:Capn5 APN 7 98125273 missense probably damaging 1.00
IGL01926:Capn5 APN 7 98128472 critical splice donor site probably null
IGL02076:Capn5 APN 7 98131743 nonsense probably null
IGL02505:Capn5 APN 7 98131196 missense possibly damaging 0.85
BB007:Capn5 UTSW 7 98123878 missense probably benign
BB017:Capn5 UTSW 7 98123878 missense probably benign
PIT4466001:Capn5 UTSW 7 98123988 missense probably benign 0.00
R0178:Capn5 UTSW 7 98132891 missense probably damaging 1.00
R0518:Capn5 UTSW 7 98132882 missense probably damaging 1.00
R0521:Capn5 UTSW 7 98132882 missense probably damaging 1.00
R1459:Capn5 UTSW 7 98131842 missense possibly damaging 0.84
R2005:Capn5 UTSW 7 98129363 missense probably benign
R2258:Capn5 UTSW 7 98135875 missense probably damaging 0.99
R2327:Capn5 UTSW 7 98126367 missense probably benign 0.07
R4032:Capn5 UTSW 7 98129246 missense probably damaging 0.96
R4620:Capn5 UTSW 7 98129371 missense probably damaging 0.98
R4717:Capn5 UTSW 7 98123919 missense probably benign 0.02
R4777:Capn5 UTSW 7 98131718 missense probably damaging 1.00
R4823:Capn5 UTSW 7 98126441 missense probably damaging 1.00
R4841:Capn5 UTSW 7 98131672 splice site probably null
R4965:Capn5 UTSW 7 98126417 missense probably damaging 0.99
R5568:Capn5 UTSW 7 98125930 missense probably damaging 1.00
R5732:Capn5 UTSW 7 98129386 missense possibly damaging 0.95
R5792:Capn5 UTSW 7 98131195 missense probably benign 0.09
R6892:Capn5 UTSW 7 98135941 missense probably damaging 1.00
R6923:Capn5 UTSW 7 98129254 missense probably damaging 1.00
R7095:Capn5 UTSW 7 98125831 missense probably benign 0.10
R7391:Capn5 UTSW 7 98131219 missense probably benign 0.02
R7553:Capn5 UTSW 7 98124024 missense probably damaging 1.00
R7930:Capn5 UTSW 7 98123878 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGAAGCTGTCTCTGAACCCC -3'
(R):5'- TGCCATGAGGTTTGCTTAGCTC -3'

Sequencing Primer
(F):5'- CCAGCGGCTATCTGATGTC -3'
(R):5'- GTTTTGAACCCCATCTGCACATTTG -3'
Posted On2015-03-25