Incidental Mutation 'R3797:Slc35g3'
ID272805
Institutional Source Beutler Lab
Gene Symbol Slc35g3
Ensembl Gene ENSMUSG00000018776
Gene Namesolute carrier family 35, member G3
Synonyms
MMRRC Submission 040758-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R3797 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location69759890-69761968 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 69760917 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 103 (F103L)
Ref Sequence ENSEMBL: ENSMUSP00000156297 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058470] [ENSMUST00000071213] [ENSMUST00000102586] [ENSMUST00000108640] [ENSMUST00000231829]
Predicted Effect probably benign
Transcript: ENSMUST00000058470
SMART Domains Protein: ENSMUSP00000050771
Gene: ENSMUSG00000005198

DomainStartEndE-ValueType
Blast:RPOLA_N 110 179 5e-37 BLAST
RPOLA_N 246 549 7.02e-203 SMART
Pfam:RNA_pol_Rpb1_4 716 823 3.6e-39 PFAM
Pfam:RNA_pol_Rpb1_5 830 1428 2e-101 PFAM
Pfam:RNA_pol_Rpb1_6 896 1079 1.7e-70 PFAM
Pfam:RNA_pol_Rpb1_7 1164 1299 1.7e-57 PFAM
Pfam:RNA_pol_Rpb1_R 1555 1568 2.1e-3 PFAM
Pfam:RNA_pol_Rpb1_R 1616 1629 8.8e-4 PFAM
Pfam:RNA_pol_Rpb1_R 1630 1643 1.9e-5 PFAM
Pfam:RNA_pol_Rpb1_R 1644 1657 2.3e-4 PFAM
Pfam:RNA_pol_Rpb1_R 1658 1671 2.2e-4 PFAM
Pfam:RNA_pol_Rpb1_R 1672 1685 2.4e-4 PFAM
Pfam:RNA_pol_Rpb1_R 1686 1699 2.5e-4 PFAM
Pfam:RNA_pol_Rpb1_R 1700 1713 2.5e-4 PFAM
Pfam:RNA_pol_Rpb1_R 1714 1727 2.5e-4 PFAM
Pfam:RNA_pol_Rpb1_R 1728 1741 2.6e-4 PFAM
Pfam:RNA_pol_Rpb1_R 1742 1755 5.3e-6 PFAM
Pfam:RNA_pol_Rpb1_R 1757 1769 5.8e-4 PFAM
Pfam:RNA_pol_Rpb1_R 1784 1797 2.6e-4 PFAM
Pfam:RNA_pol_Rpb1_R 1798 1811 4.8e-4 PFAM
Pfam:RNA_pol_Rpb1_R 1826 1839 4.3e-4 PFAM
Pfam:RNA_pol_Rpb1_R 1841 1853 2e-3 PFAM
Pfam:RNA_pol_Rpb1_R 1854 1867 6.9e-6 PFAM
Pfam:RNA_pol_Rpb1_R 1868 1881 3.7e-6 PFAM
Pfam:RNA_pol_Rpb1_R 1882 1895 1.2e-4 PFAM
Pfam:RNA_pol_Rpb1_R 1896 1909 5e-6 PFAM
Pfam:RNA_pol_Rpb1_R 1910 1923 2.5e-5 PFAM
Pfam:RNA_pol_Rpb1_R 1924 1936 2e-4 PFAM
Pfam:RNA_pol_Rpb1_R 1931 1954 2.6e-3 PFAM
Pfam:RNA_pol_Rpb1_R 1948 1960 2.5e-3 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000071213
SMART Domains Protein: ENSMUSP00000071200
Gene: ENSMUSG00000005198

DomainStartEndE-ValueType
Blast:RPOLA_N 110 179 5e-37 BLAST
RPOLA_N 246 549 7.02e-203 SMART
Pfam:RNA_pol_Rpb1_4 716 823 1.8e-41 PFAM
Pfam:RNA_pol_Rpb1_5 830 1428 4.8e-104 PFAM
Pfam:RNA_pol_Rpb1_6 896 1079 5.2e-74 PFAM
Pfam:RNA_pol_Rpb1_7 1164 1299 1.4e-55 PFAM
low complexity region 1503 1522 N/A INTRINSIC
low complexity region 1524 1549 N/A INTRINSIC
Pfam:RNA_pol_Rpb1_R 1578 1591 2.7e-5 PFAM
Pfam:RNA_pol_Rpb1_R 1592 1605 2.5e-6 PFAM
Pfam:RNA_pol_Rpb1_R 1606 1619 2.7e-5 PFAM
Pfam:RNA_pol_Rpb1_R 1620 1633 2.5e-5 PFAM
Pfam:RNA_pol_Rpb1_R 1634 1647 2.5e-5 PFAM
Pfam:RNA_pol_Rpb1_R 1648 1661 2.4e-5 PFAM
Pfam:RNA_pol_Rpb1_R 1662 1675 2.4e-5 PFAM
Pfam:RNA_pol_Rpb1_R 1676 1689 2.6e-5 PFAM
Pfam:RNA_pol_Rpb1_R 1690 1703 2.3e-5 PFAM
Pfam:RNA_pol_Rpb1_R 1704 1717 5.2e-7 PFAM
Pfam:RNA_pol_Rpb1_R 1718 1731 5.5e-5 PFAM
Pfam:RNA_pol_Rpb1_R 1732 1745 1.6e-5 PFAM
Pfam:RNA_pol_Rpb1_R 1746 1759 8.6e-5 PFAM
Pfam:RNA_pol_Rpb1_R 1760 1773 2e-4 PFAM
Pfam:RNA_pol_Rpb1_R 1788 1801 3.3e-5 PFAM
Pfam:RNA_pol_Rpb1_R 1802 1815 2.4e-4 PFAM
Pfam:RNA_pol_Rpb1_R 1816 1829 8.3e-7 PFAM
Pfam:RNA_pol_Rpb1_R 1830 1843 2.2e-6 PFAM
Pfam:RNA_pol_Rpb1_R 1844 1857 1.6e-5 PFAM
Pfam:RNA_pol_Rpb1_R 1858 1871 2.8e-6 PFAM
Pfam:RNA_pol_Rpb1_R 1872 1885 6e-7 PFAM
Pfam:RNA_pol_Rpb1_R 1886 1899 4.6e-6 PFAM
Pfam:RNA_pol_Rpb1_R 1893 1909 4.8e-5 PFAM
Pfam:RNA_pol_Rpb1_R 1903 1916 2.8e-6 PFAM
Pfam:RNA_pol_Rpb1_R 1910 1923 1.6e-4 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102586
AA Change: F81L

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000099646
Gene: ENSMUSG00000018776
AA Change: F81L

DomainStartEndE-ValueType
low complexity region 38 49 N/A INTRINSIC
transmembrane domain 64 86 N/A INTRINSIC
transmembrane domain 96 115 N/A INTRINSIC
transmembrane domain 128 150 N/A INTRINSIC
transmembrane domain 182 204 N/A INTRINSIC
transmembrane domain 211 233 N/A INTRINSIC
transmembrane domain 243 265 N/A INTRINSIC
transmembrane domain 277 299 N/A INTRINSIC
transmembrane domain 304 326 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108640
SMART Domains Protein: ENSMUSP00000104280
Gene: ENSMUSG00000018750

DomainStartEndE-ValueType
BTB 30 166 2e-15 SMART
ZnF_C2H2 210 230 1.91e1 SMART
low complexity region 240 261 N/A INTRINSIC
low complexity region 274 283 N/A INTRINSIC
ZnF_C2H2 285 307 1.53e-1 SMART
ZnF_C2H2 313 335 1.91e1 SMART
ZnF_C2H2 341 364 5.81e-2 SMART
low complexity region 422 445 N/A INTRINSIC
low complexity region 461 482 N/A INTRINSIC
low complexity region 485 532 N/A INTRINSIC
low complexity region 551 568 N/A INTRINSIC
coiled coil region 601 637 N/A INTRINSIC
low complexity region 650 662 N/A INTRINSIC
low complexity region 664 673 N/A INTRINSIC
ZnF_C2H2 700 722 3.78e-1 SMART
ZnF_C2H2 739 761 6.23e-2 SMART
low complexity region 799 820 N/A INTRINSIC
low complexity region 947 961 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000231829
AA Change: F103L

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
Meta Mutation Damage Score 0.0676 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (39/39)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf3 T C 5: 30,196,823 I736V possibly damaging Het
Alpk3 C A 7: 81,092,753 P773T probably benign Het
B4galt1 G A 4: 40,807,258 T376I probably benign Het
Basp1 C A 15: 25,364,312 probably benign Het
Capn5 C T 7: 98,125,829 G535R probably null Het
Ccdc170 G A 10: 4,560,920 V660I possibly damaging Het
Cdc73 A T 1: 143,677,723 D215E probably benign Het
Clec14a G A 12: 58,267,909 A309V probably benign Het
Clns1a G A 7: 97,696,835 G36R probably benign Het
Cops7a C T 6: 124,959,832 R252H probably damaging Het
Csmd2 C T 4: 128,517,595 P2469S probably benign Het
Dsp T A 13: 38,177,284 probably null Het
Eif3d A G 15: 77,968,569 F4S probably damaging Het
Ephb1 T C 9: 101,971,267 T611A probably damaging Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Fgfr1 G A 8: 25,572,437 D663N probably damaging Het
Gm5592 G A 7: 41,157,835 probably benign Het
Itgb8 T C 12: 119,163,469 I683M possibly damaging Het
Kcnip3 A G 2: 127,482,014 S32P probably benign Het
Limch1 A G 5: 66,969,079 T8A probably damaging Het
Lmf1 G A 17: 25,654,471 V317M probably damaging Het
Ltbp1 A G 17: 75,362,630 Q1455R probably damaging Het
Marc2 T C 1: 184,841,308 E131G possibly damaging Het
Olfr620 C T 7: 103,611,447 R302Q probably benign Het
Pak7 T C 2: 136,100,826 I465V probably benign Het
Pcdhgb8 T C 18: 37,762,675 I266T probably benign Het
Pde4d T C 13: 109,632,897 S40P probably benign Het
Phrf1 C T 7: 141,259,918 R243* probably null Het
Polk A T 13: 96,486,982 probably benign Het
Ppl T C 16: 5,104,550 probably benign Het
Rab11fip3 A G 17: 26,068,526 C218R possibly damaging Het
Setd2 T C 9: 110,549,571 V818A probably benign Het
Skida1 C A 2: 18,045,897 E815* probably null Het
Svil T A 18: 5,060,534 C802S probably benign Het
Trim7 A G 11: 48,845,670 probably null Het
Ugt3a1 G A 15: 9,310,641 W336* probably null Het
Vmn2r72 T C 7: 85,738,077 S760G probably benign Het
Vps13a T C 19: 16,745,947 probably null Het
Wdfy4 A T 14: 33,140,645 I590N probably damaging Het
Xdh T C 17: 73,907,658 E764G probably damaging Het
Xpnpep1 A T 19: 53,006,342 V285D probably benign Het
Zfp934 T C 13: 62,517,888 K313R probably benign Het
Other mutations in Slc35g3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00936:Slc35g3 APN 11 69760491 unclassified probably null
IGL03064:Slc35g3 APN 11 69761069 missense possibly damaging 0.62
R1615:Slc35g3 UTSW 11 69760542 missense probably damaging 0.99
R2086:Slc35g3 UTSW 11 69760946 missense probably damaging 1.00
R3796:Slc35g3 UTSW 11 69760917 missense probably benign 0.02
R3798:Slc35g3 UTSW 11 69760917 missense probably benign 0.02
R3799:Slc35g3 UTSW 11 69760917 missense probably benign 0.02
R5014:Slc35g3 UTSW 11 69761040 nonsense probably null
R5727:Slc35g3 UTSW 11 69760454 missense probably benign 0.00
R5774:Slc35g3 UTSW 11 69760298 missense probably damaging 1.00
R5935:Slc35g3 UTSW 11 69761683 start codon destroyed probably null
R6634:Slc35g3 UTSW 11 69760283 missense probably damaging 1.00
R7043:Slc35g3 UTSW 11 69761650 missense probably benign 0.03
X0021:Slc35g3 UTSW 11 69760737 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAACCTTTGCGGACAGTGAC -3'
(R):5'- TAACAGGCTGCCAGTCATC -3'

Sequencing Primer
(F):5'- ACAGTGACTGCGTTGCC -3'
(R):5'- TGACTTCACCCAGCCATCG -3'
Posted On2015-03-25