Incidental Mutation 'R3797:Clec14a'
List |< first << previous [record 8 of 43] next >> last >|
ID272806
Institutional Source Beutler Lab
Gene Symbol Clec14a
Ensembl Gene ENSMUSG00000045930
Gene NameC-type lectin domain family 14, member a
Synonyms
MMRRC Submission 040758-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R3797 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location58264720-58269290 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 58267909 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 309 (A309V)
Ref Sequence ENSEMBL: ENSMUSP00000054451 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062254]
Predicted Effect probably benign
Transcript: ENSMUST00000062254
AA Change: A309V

PolyPhen 2 Score 0.335 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000054451
Gene: ENSMUSG00000045930
AA Change: A309V

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
CLECT 31 172 1.4e-5 SMART
EGF 246 288 1.85e0 SMART
transmembrane domain 388 410 N/A INTRINSIC
Meta Mutation Damage Score 0.0756 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the C-type lectin/C-type lectin-like domain (CTL/CTLD) superfamily. Members of this family share a common protein fold and have diverse functions, such as cell adhesion, cell-cell signalling, glycoprotein turnover, and roles in inflammation and immune response. This family member plays a role in cell-cell adhesion and angiogenesis. It functions in filopodia formation, cell migration and tube formation. Due to its presence at higher levels in tumor endothelium than in normal tissue endothelium, it is considered to be a candidate for tumor vascular targeting. [provided by RefSeq, Jan 2012]
PHENOTYPE: No notable pheontype was detected in a high-throughput screen of homozygous mutant mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf3 T C 5: 30,196,823 I736V possibly damaging Het
Alpk3 C A 7: 81,092,753 P773T probably benign Het
B4galt1 G A 4: 40,807,258 T376I probably benign Het
Basp1 C A 15: 25,364,312 probably benign Het
Capn5 C T 7: 98,125,829 G535R probably null Het
Ccdc170 G A 10: 4,560,920 V660I possibly damaging Het
Cdc73 A T 1: 143,677,723 D215E probably benign Het
Clns1a G A 7: 97,696,835 G36R probably benign Het
Cops7a C T 6: 124,959,832 R252H probably damaging Het
Csmd2 C T 4: 128,517,595 P2469S probably benign Het
Dsp T A 13: 38,177,284 probably null Het
Eif3d A G 15: 77,968,569 F4S probably damaging Het
Ephb1 T C 9: 101,971,267 T611A probably damaging Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Fgfr1 G A 8: 25,572,437 D663N probably damaging Het
Gm5592 G A 7: 41,157,835 probably benign Het
Itgb8 T C 12: 119,163,469 I683M possibly damaging Het
Kcnip3 A G 2: 127,482,014 S32P probably benign Het
Limch1 A G 5: 66,969,079 T8A probably damaging Het
Lmf1 G A 17: 25,654,471 V317M probably damaging Het
Ltbp1 A G 17: 75,362,630 Q1455R probably damaging Het
Marc2 T C 1: 184,841,308 E131G possibly damaging Het
Olfr620 C T 7: 103,611,447 R302Q probably benign Het
Pak7 T C 2: 136,100,826 I465V probably benign Het
Pcdhgb8 T C 18: 37,762,675 I266T probably benign Het
Pde4d T C 13: 109,632,897 S40P probably benign Het
Phrf1 C T 7: 141,259,918 R243* probably null Het
Polk A T 13: 96,486,982 probably benign Het
Ppl T C 16: 5,104,550 probably benign Het
Rab11fip3 A G 17: 26,068,526 C218R possibly damaging Het
Setd2 T C 9: 110,549,571 V818A probably benign Het
Skida1 C A 2: 18,045,897 E815* probably null Het
Slc35g3 A G 11: 69,760,917 F103L probably benign Het
Svil T A 18: 5,060,534 C802S probably benign Het
Trim7 A G 11: 48,845,670 probably null Het
Ugt3a1 G A 15: 9,310,641 W336* probably null Het
Vmn2r72 T C 7: 85,738,077 S760G probably benign Het
Vps13a T C 19: 16,745,947 probably null Het
Wdfy4 A T 14: 33,140,645 I590N probably damaging Het
Xdh T C 17: 73,907,658 E764G probably damaging Het
Xpnpep1 A T 19: 53,006,342 V285D probably benign Het
Zfp934 T C 13: 62,517,888 K313R probably benign Het
Other mutations in Clec14a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01933:Clec14a APN 12 58268318 missense probably damaging 1.00
IGL02109:Clec14a APN 12 58268148 missense probably benign 0.00
IGL02121:Clec14a APN 12 58268437 missense probably damaging 1.00
IGL02136:Clec14a APN 12 58268629 missense probably damaging 1.00
IGL02818:Clec14a APN 12 58268102 missense probably damaging 1.00
R0379:Clec14a UTSW 12 58268794 missense possibly damaging 0.90
R0382:Clec14a UTSW 12 58268617 missense probably damaging 1.00
R0419:Clec14a UTSW 12 58267665 missense probably damaging 0.97
R2972:Clec14a UTSW 12 58267574 missense probably damaging 1.00
R3796:Clec14a UTSW 12 58267909 missense probably benign 0.34
R3876:Clec14a UTSW 12 58268644 missense possibly damaging 0.79
R4602:Clec14a UTSW 12 58267981 missense probably benign 0.03
R4708:Clec14a UTSW 12 58267703 missense probably benign 0.00
R4994:Clec14a UTSW 12 58268284 missense probably damaging 1.00
R5193:Clec14a UTSW 12 58268614 missense probably damaging 1.00
R5489:Clec14a UTSW 12 58268249 missense probably damaging 1.00
R5671:Clec14a UTSW 12 58267826 missense probably benign 0.05
R6318:Clec14a UTSW 12 58268215 missense probably damaging 1.00
R6388:Clec14a UTSW 12 58267457 makesense probably null
R6828:Clec14a UTSW 12 58268504 missense probably damaging 1.00
R7065:Clec14a UTSW 12 58268794 missense possibly damaging 0.90
R7418:Clec14a UTSW 12 58268647 missense probably damaging 0.99
R7635:Clec14a UTSW 12 58268528 missense probably damaging 1.00
R7666:Clec14a UTSW 12 58267757 missense probably benign 0.05
R7908:Clec14a UTSW 12 58267679 missense possibly damaging 0.63
X0024:Clec14a UTSW 12 58268326 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGTTCAGGACCACGCTTCC -3'
(R):5'- CTGCATCCAGGAAGAGACAAGC -3'

Sequencing Primer
(F):5'- ACCACGCTTCCTGATGGTGTG -3'
(R):5'- ACACTGGGACGGGCTTTTC -3'
Posted On2015-03-25