Incidental Mutation 'R3797:Zfp934'
ID272809
Institutional Source Beutler Lab
Gene Symbol Zfp934
Ensembl Gene ENSMUSG00000074865
Gene Namezinc finger protein 934
Synonyms
MMRRC Submission 040758-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.298) question?
Stock #R3797 (G1)
Quality Score175
Status Validated
Chromosome13
Chromosomal Location62479827-62571199 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 62517888 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 313 (K313R)
Ref Sequence ENSEMBL: ENSMUSP00000152492 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076195] [ENSMUST00000082203] [ENSMUST00000101547] [ENSMUST00000220648] [ENSMUST00000221250] [ENSMUST00000222429] [ENSMUST00000222746] [ENSMUST00000222852]
Predicted Effect probably benign
Transcript: ENSMUST00000076195
SMART Domains Protein: ENSMUSP00000075552
Gene: ENSMUSG00000055228

DomainStartEndE-ValueType
KRAB 4 66 8.26e-16 SMART
ZnF_C2H2 133 155 2.09e-3 SMART
ZnF_C2H2 161 183 1.4e-4 SMART
ZnF_C2H2 189 211 2.57e-3 SMART
ZnF_C2H2 217 239 5.5e-3 SMART
ZnF_C2H2 245 267 7.26e-3 SMART
ZnF_C2H2 273 295 1.4e-4 SMART
ZnF_C2H2 301 323 8.6e-5 SMART
ZnF_C2H2 329 351 1.2e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000082203
SMART Domains Protein: ENSMUSP00000080837
Gene: ENSMUSG00000074865

DomainStartEndE-ValueType
Blast:KRAB 1 34 3e-16 BLAST
ZnF_C2H2 101 123 1.04e-3 SMART
ZnF_C2H2 129 149 1.68e1 SMART
ZnF_C2H2 157 179 2.75e-3 SMART
ZnF_C2H2 185 207 1.98e-4 SMART
ZnF_C2H2 213 235 3.21e-4 SMART
ZnF_C2H2 241 263 3.44e-4 SMART
ZnF_C2H2 269 292 4.98e-1 SMART
ZnF_C2H2 298 320 4.87e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000101547
AA Change: K345R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000099083
Gene: ENSMUSG00000074865
AA Change: K345R

DomainStartEndE-ValueType
KRAB 3 65 5.01e-15 SMART
ZnF_C2H2 132 154 1.04e-3 SMART
ZnF_C2H2 160 180 1.68e1 SMART
ZnF_C2H2 188 210 2.75e-3 SMART
ZnF_C2H2 216 238 1.98e-4 SMART
ZnF_C2H2 244 266 3.21e-4 SMART
ZnF_C2H2 272 294 3.44e-4 SMART
ZnF_C2H2 300 322 2.27e-4 SMART
ZnF_C2H2 328 350 3.44e-4 SMART
ZnF_C2H2 356 378 9.22e-5 SMART
ZnF_C2H2 384 406 2.43e-4 SMART
ZnF_C2H2 412 434 1.3e-4 SMART
ZnF_C2H2 440 462 4.87e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000220648
AA Change: K313R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000221250
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221494
Predicted Effect probably benign
Transcript: ENSMUST00000222429
Predicted Effect probably benign
Transcript: ENSMUST00000222746
Predicted Effect probably benign
Transcript: ENSMUST00000222852
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (39/39)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf3 T C 5: 30,196,823 I736V possibly damaging Het
Alpk3 C A 7: 81,092,753 P773T probably benign Het
B4galt1 G A 4: 40,807,258 T376I probably benign Het
Basp1 C A 15: 25,364,312 probably benign Het
Capn5 C T 7: 98,125,829 G535R probably null Het
Ccdc170 G A 10: 4,560,920 V660I possibly damaging Het
Cdc73 A T 1: 143,677,723 D215E probably benign Het
Clec14a G A 12: 58,267,909 A309V probably benign Het
Clns1a G A 7: 97,696,835 G36R probably benign Het
Cops7a C T 6: 124,959,832 R252H probably damaging Het
Csmd2 C T 4: 128,517,595 P2469S probably benign Het
Dsp T A 13: 38,177,284 probably null Het
Eif3d A G 15: 77,968,569 F4S probably damaging Het
Ephb1 T C 9: 101,971,267 T611A probably damaging Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Fgfr1 G A 8: 25,572,437 D663N probably damaging Het
Gm5592 G A 7: 41,157,835 probably benign Het
Itgb8 T C 12: 119,163,469 I683M possibly damaging Het
Kcnip3 A G 2: 127,482,014 S32P probably benign Het
Limch1 A G 5: 66,969,079 T8A probably damaging Het
Lmf1 G A 17: 25,654,471 V317M probably damaging Het
Ltbp1 A G 17: 75,362,630 Q1455R probably damaging Het
Marc2 T C 1: 184,841,308 E131G possibly damaging Het
Olfr620 C T 7: 103,611,447 R302Q probably benign Het
Pak7 T C 2: 136,100,826 I465V probably benign Het
Pcdhgb8 T C 18: 37,762,675 I266T probably benign Het
Pde4d T C 13: 109,632,897 S40P probably benign Het
Phrf1 C T 7: 141,259,918 R243* probably null Het
Polk A T 13: 96,486,982 probably benign Het
Ppl T C 16: 5,104,550 probably benign Het
Rab11fip3 A G 17: 26,068,526 C218R possibly damaging Het
Setd2 T C 9: 110,549,571 V818A probably benign Het
Skida1 C A 2: 18,045,897 E815* probably null Het
Slc35g3 A G 11: 69,760,917 F103L probably benign Het
Svil T A 18: 5,060,534 C802S probably benign Het
Trim7 A G 11: 48,845,670 probably null Het
Ugt3a1 G A 15: 9,310,641 W336* probably null Het
Vmn2r72 T C 7: 85,738,077 S760G probably benign Het
Vps13a T C 19: 16,745,947 probably null Het
Wdfy4 A T 14: 33,140,645 I590N probably damaging Het
Xdh T C 17: 73,907,658 E764G probably damaging Het
Xpnpep1 A T 19: 53,006,342 V285D probably benign Het
Other mutations in Zfp934
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1915:Zfp934 UTSW 13 62517955 missense probably damaging 1.00
R1957:Zfp934 UTSW 13 62518294 missense possibly damaging 0.83
R2113:Zfp934 UTSW 13 62518693 missense probably damaging 0.98
R2145:Zfp934 UTSW 13 62517834 missense probably damaging 1.00
R3732:Zfp934 UTSW 13 62517785 missense probably damaging 1.00
R4326:Zfp934 UTSW 13 62517559 missense probably benign 0.01
R4327:Zfp934 UTSW 13 62517559 missense probably benign 0.01
R4909:Zfp934 UTSW 13 62517954 missense probably damaging 1.00
R5236:Zfp934 UTSW 13 62517713 missense probably damaging 1.00
R5237:Zfp934 UTSW 13 62517838 missense probably damaging 1.00
R6305:Zfp934 UTSW 13 62518556 missense probably damaging 0.99
R6729:Zfp934 UTSW 13 62492932 missense probably damaging 1.00
R7072:Zfp934 UTSW 13 62520525 missense probably damaging 0.99
R7186:Zfp934 UTSW 13 62492390 missense probably benign 0.12
R7235:Zfp934 UTSW 13 62518150 missense
R7453:Zfp934 UTSW 13 62518703 missense probably benign 0.40
R7552:Zfp934 UTSW 13 62492891 missense probably damaging 1.00
R7589:Zfp934 UTSW 13 62518316 missense
R7624:Zfp934 UTSW 13 62518524 missense probably benign 0.27
R7651:Zfp934 UTSW 13 62518513 missense probably benign
R7780:Zfp934 UTSW 13 62518544 missense possibly damaging 0.92
R7857:Zfp934 UTSW 13 62517547 missense
R7891:Zfp934 UTSW 13 62520189 missense probably benign 0.35
R8130:Zfp934 UTSW 13 62520171 critical splice donor site probably null
R8298:Zfp934 UTSW 13 62518481 missense
Predicted Primers PCR Primer
(F):5'- AGGGTTTCTCTCCAGTATGTGTTCT -3'
(R):5'- GAGAGAAACCCTACAAATGTGATC -3'

Sequencing Primer
(F):5'- CTGTATTGAGAAAAGGCTTTATCGC -3'
(R):5'- ACCCTACAAATGTGATCAATGTG -3'
Posted On2015-03-25