Mutagenetix > Incidental Mutations

Incidental Mutation 'R3797:Polk'

272810

Institutional Source

Beutler Lab

Gene Symbol

Polk

Ensembl Gene

ENSMUSG00000021668

Gene Name

polymerase (DNA directed), kappa

Synonyms

Dinb1

MMRRC Submission

040758-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.176) question?

Stock #

R3797 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

96480690-96542579 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to T at 96486982 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000152192 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022172] [ENSMUST00000091387] [ENSMUST00000165358] [ENSMUST00000220977] [ENSMUST00000221645] [ENSMUST00000221899] [ENSMUST00000222075] [ENSMUST00000222143] [ENSMUST00000222389]

Predicted Effect

probably benign
Transcript: ENSMUST00000022172

SMART Domains

Protein: ENSMUSP00000022172
Gene: ENSMUSG00000021668

Domain	Start	End	E-Value	Type
Pfam:IMS	105	324	1.7e-47	PFAM
Pfam:IMS_C	406	525	5.5e-22	PFAM
PDB:2LSJ\|B	559	582	9e-8	PDB
ZnF_Rad18	619	645	2.89e-9	SMART
ZnF_Rad18	761	787	2.31e-8	SMART
low complexity region	828	839	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000091387

SMART Domains

Protein: ENSMUSP00000088950
Gene: ENSMUSG00000021668

Domain	Start	End	E-Value	Type
Pfam:IMS	105	265	1.1e-37	PFAM
Pfam:IMS_C	346	469	8.8e-19	PFAM
PDB:2LSJ\|B	500	523	9e-8	PDB
ZnF_Rad18	560	586	2.89e-9	SMART
ZnF_Rad18	702	728	2.31e-8	SMART
low complexity region	769	780	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000165358

Predicted Effect

probably benign
Transcript: ENSMUST00000220977

Predicted Effect

probably benign
Transcript: ENSMUST00000221645

Predicted Effect

probably benign
Transcript: ENSMUST00000221899

Predicted Effect

probably benign
Transcript: ENSMUST00000222075

Predicted Effect

probably benign
Transcript: ENSMUST00000222143

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222268

Predicted Effect

probably benign
Transcript: ENSMUST00000222389

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.2%
20x: 94.9%

Validation Efficiency

100% (39/39)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DNA polymerase type-Y family of proteins. The encoded protein is a specialized DNA polymerase that catalyzes translesion DNA synthesis, which allows DNA replication in the presence of DNA lesions. Human cell lines lacking a functional copy of this gene exhibit impaired genome integrity and enhanced susceptibility to oxidative damage. Mutations in this gene that impair enzyme activity may be associated with prostate cancer in human patients. [provided by RefSeq, Sep 2016]
PHENOTYPE: Homozygous mutation of this gene that results in a truncated transcript results in a higher rate of spontaneous germline expanded simple tandem repeat mutations. Homozyogus null mice exhibit normal immunoglobulin gene somatic hypermutation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrf3	T	C	5: 30,196,823	I736V	possibly damaging	Het
Alpk3	C	A	7: 81,092,753	P773T	probably benign	Het
B4galt1	G	A	4: 40,807,258	T376I	probably benign	Het
Basp1	C	A	15: 25,364,312		probably benign	Het
Capn5	C	T	7: 98,125,829	G535R	probably null	Het
Ccdc170	G	A	10: 4,560,920	V660I	possibly damaging	Het
Cdc73	A	T	1: 143,677,723	D215E	probably benign	Het
Clec14a	G	A	12: 58,267,909	A309V	probably benign	Het
Clns1a	G	A	7: 97,696,835	G36R	probably benign	Het
Cops7a	C	T	6: 124,959,832	R252H	probably damaging	Het
Csmd2	C	T	4: 128,517,595	P2469S	probably benign	Het
Dsp	T	A	13: 38,177,284		probably null	Het
Eif3d	A	G	15: 77,968,569	F4S	probably damaging	Het
Ephb1	T	C	9: 101,971,267	T611A	probably damaging	Het
Fam43b	G	C	4: 138,395,098	R304G	probably benign	Het
Fgfr1	G	A	8: 25,572,437	D663N	probably damaging	Het
Gm5592	G	A	7: 41,157,835		probably benign	Het
Itgb8	T	C	12: 119,163,469	I683M	possibly damaging	Het
Kcnip3	A	G	2: 127,482,014	S32P	probably benign	Het
Limch1	A	G	5: 66,969,079	T8A	probably damaging	Het
Lmf1	G	A	17: 25,654,471	V317M	probably damaging	Het
Ltbp1	A	G	17: 75,362,630	Q1455R	probably damaging	Het
Marc2	T	C	1: 184,841,308	E131G	possibly damaging	Het
Olfr620	C	T	7: 103,611,447	R302Q	probably benign	Het
Pak7	T	C	2: 136,100,826	I465V	probably benign	Het
Pcdhgb8	T	C	18: 37,762,675	I266T	probably benign	Het
Pde4d	T	C	13: 109,632,897	S40P	probably benign	Het
Phrf1	C	T	7: 141,259,918	R243*	probably null	Het
Ppl	T	C	16: 5,104,550		probably benign	Het
Rab11fip3	A	G	17: 26,068,526	C218R	possibly damaging	Het
Setd2	T	C	9: 110,549,571	V818A	probably benign	Het
Skida1	C	A	2: 18,045,897	E815*	probably null	Het
Slc35g3	A	G	11: 69,760,917	F103L	probably benign	Het
Svil	T	A	18: 5,060,534	C802S	probably benign	Het
Trim7	A	G	11: 48,845,670		probably null	Het
Ugt3a1	G	A	15: 9,310,641	W336*	probably null	Het
Vmn2r72	T	C	7: 85,738,077	S760G	probably benign	Het
Vps13a	T	C	19: 16,745,947		probably null	Het
Wdfy4	A	T	14: 33,140,645	I590N	probably damaging	Het
Xdh	T	C	17: 73,907,658	E764G	probably damaging	Het
Xpnpep1	A	T	19: 53,006,342	V285D	probably benign	Het
Zfp934	T	C	13: 62,517,888	K313R	probably benign	Het

Other mutations in Polk

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00491:Polk	APN	13	96496760	missense	probably benign	0.25
IGL01803:Polk	APN	13	96504522	missense	probably damaging	1.00
IGL01949:Polk	APN	13	96483538	missense	probably benign	0.10
IGL01986:Polk	APN	13	96483823	missense	probably benign	0.09
IGL02073:Polk	APN	13	96504551	missense	probably damaging	1.00
IGL03165:Polk	APN	13	96516688	missense	probably benign	0.23
IGL03184:Polk	APN	13	96483983	missense	probably benign	0.04
IGL03353:Polk	APN	13	96489211	missense	probably damaging	1.00
R0019:Polk	UTSW	13	96504616	missense	probably damaging	1.00
R0029:Polk	UTSW	13	96516670	missense	probably damaging	1.00
R0200:Polk	UTSW	13	96496822	missense	probably benign	0.11
R0357:Polk	UTSW	13	96504597	missense	probably damaging	0.99
R0485:Polk	UTSW	13	96483764	missense	probably benign	0.05
R0555:Polk	UTSW	13	96484179	missense	probably damaging	0.97
R0687:Polk	UTSW	13	96484017	missense	probably damaging	1.00
R0980:Polk	UTSW	13	96483764	missense	probably benign	0.05
R1065:Polk	UTSW	13	96508252	missense	probably damaging	1.00
R1396:Polk	UTSW	13	96484208	missense	probably benign	0.02
R1710:Polk	UTSW	13	96489204	missense	probably damaging	1.00
R1770:Polk	UTSW	13	96495442	missense	probably damaging	1.00
R1789:Polk	UTSW	13	96496632	missense	probably damaging	1.00
R1977:Polk	UTSW	13	96489228	missense	probably damaging	1.00
R2301:Polk	UTSW	13	96484144	missense	probably benign	0.09
R3934:Polk	UTSW	13	96501635	missense	possibly damaging	0.56
R4082:Polk	UTSW	13	96483673	missense	probably benign	0.17
R4307:Polk	UTSW	13	96496666	missense	possibly damaging	0.79
R4472:Polk	UTSW	13	96493905	missense	probably damaging	1.00
R4779:Polk	UTSW	13	96496491	critical splice donor site	probably null
R4795:Polk	UTSW	13	96489256	missense	probably benign	0.01
R4796:Polk	UTSW	13	96489256	missense	probably benign	0.01
R4810:Polk	UTSW	13	96483495	missense	possibly damaging	0.90
R5002:Polk	UTSW	13	96489244	missense	probably damaging	1.00
R5271:Polk	UTSW	13	96483539	missense	probably benign	0.09
R5415:Polk	UTSW	13	96483955	missense	probably benign
R5459:Polk	UTSW	13	96495476	missense	probably damaging	1.00
R5535:Polk	UTSW	13	96495497	missense	probably damaging	1.00
R5619:Polk	UTSW	13	96483556	missense	probably damaging	1.00
R5757:Polk	UTSW	13	96484252	missense	probably benign	0.03
R5801:Polk	UTSW	13	96483586	missense	probably damaging	1.00
R5923:Polk	UTSW	13	96495415	missense	probably damaging	1.00
R6365:Polk	UTSW	13	96484009	missense	probably damaging	1.00
R6670:Polk	UTSW	13	96496630	nonsense	probably null
R6831:Polk	UTSW	13	96495491	missense	possibly damaging	0.87
R6932:Polk	UTSW	13	96516681	missense	probably damaging	1.00
R7216:Polk	UTSW	13	96508220	missense	probably benign	0.32
R7654:Polk	UTSW	13	96496813	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- CCCATCAGTCTTAACCGCAG -3'
(R):5'- TCATGCAGGAAGTGTGAGCTC -3'

Sequencing Primer
(F):5'- CAGGGGGTGTGGAGAACCC -3'
(R):5'- TGACTTTCAAAAGAGAATTACCCCAG -3'

Posted On

2015-03-25