Incidental Mutation 'R3797:Ugt3a1'
List |< first << previous [record 37 of 43] next >> last >|
ID272812
Institutional Source Beutler Lab
Gene Symbol Ugt3a1
Ensembl Gene ENSMUSG00000072664
Gene NameUDP glycosyltransferases 3 family, polypeptide A1
Synonyms
MMRRC Submission 040758-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R3797 (G1)
Quality Score149
Status Validated
Chromosome15
Chromosomal Location9276888-9315032 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 9310641 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Stop codon at position 336 (W336*)
Ref Sequence ENSEMBL: ENSMUSP00000022861 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022861]
Predicted Effect probably null
Transcript: ENSMUST00000022861
AA Change: W336*
SMART Domains Protein: ENSMUSP00000022861
Gene: ENSMUSG00000072664
AA Change: W336*

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:UDPGT 23 521 1.4e-98 PFAM
Pfam:Glyco_tran_28_C 300 451 3.7e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145326
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175695
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176173
Meta Mutation Damage Score 0.9704 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (39/39)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf3 T C 5: 30,196,823 I736V possibly damaging Het
Alpk3 C A 7: 81,092,753 P773T probably benign Het
B4galt1 G A 4: 40,807,258 T376I probably benign Het
Basp1 C A 15: 25,364,312 probably benign Het
Capn5 C T 7: 98,125,829 G535R probably null Het
Ccdc170 G A 10: 4,560,920 V660I possibly damaging Het
Cdc73 A T 1: 143,677,723 D215E probably benign Het
Clec14a G A 12: 58,267,909 A309V probably benign Het
Clns1a G A 7: 97,696,835 G36R probably benign Het
Cops7a C T 6: 124,959,832 R252H probably damaging Het
Csmd2 C T 4: 128,517,595 P2469S probably benign Het
Dsp T A 13: 38,177,284 probably null Het
Eif3d A G 15: 77,968,569 F4S probably damaging Het
Ephb1 T C 9: 101,971,267 T611A probably damaging Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Fgfr1 G A 8: 25,572,437 D663N probably damaging Het
Gm5592 G A 7: 41,157,835 probably benign Het
Itgb8 T C 12: 119,163,469 I683M possibly damaging Het
Kcnip3 A G 2: 127,482,014 S32P probably benign Het
Limch1 A G 5: 66,969,079 T8A probably damaging Het
Lmf1 G A 17: 25,654,471 V317M probably damaging Het
Ltbp1 A G 17: 75,362,630 Q1455R probably damaging Het
Marc2 T C 1: 184,841,308 E131G possibly damaging Het
Olfr620 C T 7: 103,611,447 R302Q probably benign Het
Pak7 T C 2: 136,100,826 I465V probably benign Het
Pcdhgb8 T C 18: 37,762,675 I266T probably benign Het
Pde4d T C 13: 109,632,897 S40P probably benign Het
Phrf1 C T 7: 141,259,918 R243* probably null Het
Polk A T 13: 96,486,982 probably benign Het
Ppl T C 16: 5,104,550 probably benign Het
Rab11fip3 A G 17: 26,068,526 C218R possibly damaging Het
Setd2 T C 9: 110,549,571 V818A probably benign Het
Skida1 C A 2: 18,045,897 E815* probably null Het
Slc35g3 A G 11: 69,760,917 F103L probably benign Het
Svil T A 18: 5,060,534 C802S probably benign Het
Trim7 A G 11: 48,845,670 probably null Het
Vmn2r72 T C 7: 85,738,077 S760G probably benign Het
Vps13a T C 19: 16,745,947 probably null Het
Wdfy4 A T 14: 33,140,645 I590N probably damaging Het
Xdh T C 17: 73,907,658 E764G probably damaging Het
Xpnpep1 A T 19: 53,006,342 V285D probably benign Het
Zfp934 T C 13: 62,517,888 K313R probably benign Het
Other mutations in Ugt3a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00912:Ugt3a1 APN 15 9310612 missense probably damaging 1.00
IGL01752:Ugt3a1 APN 15 9306146 missense probably damaging 1.00
IGL02438:Ugt3a1 APN 15 9291976 missense possibly damaging 0.90
PIT4354001:Ugt3a1 UTSW 15 9306360 nonsense probably null
R0127:Ugt3a1 UTSW 15 9306256 missense probably benign 0.01
R0647:Ugt3a1 UTSW 15 9310549 missense probably benign 0.00
R0841:Ugt3a1 UTSW 15 9306128 missense probably benign 0.07
R1395:Ugt3a1 UTSW 15 9306292 missense possibly damaging 0.92
R1616:Ugt3a1 UTSW 15 9306244 nonsense probably null
R2338:Ugt3a1 UTSW 15 9291973 splice site probably benign
R4305:Ugt3a1 UTSW 15 9306274 missense possibly damaging 0.92
R4385:Ugt3a1 UTSW 15 9306479 missense probably benign 0.15
R4572:Ugt3a1 UTSW 15 9306393 missense probably benign 0.00
R4611:Ugt3a1 UTSW 15 9306400 nonsense probably null
R4744:Ugt3a1 UTSW 15 9310553 missense probably benign 0.36
R5715:Ugt3a1 UTSW 15 9306344 missense probably damaging 0.96
R6036:Ugt3a1 UTSW 15 9306086 missense probably benign 0.01
R6036:Ugt3a1 UTSW 15 9306086 missense probably benign 0.01
R6156:Ugt3a1 UTSW 15 9310676 missense possibly damaging 0.83
R6228:Ugt3a1 UTSW 15 9310640 missense possibly damaging 0.81
R6344:Ugt3a1 UTSW 15 9306231 missense probably damaging 0.98
R6380:Ugt3a1 UTSW 15 9306455 missense probably benign 0.00
R6383:Ugt3a1 UTSW 15 9306455 missense probably benign 0.00
R6737:Ugt3a1 UTSW 15 9311809 missense probably benign 0.30
R6848:Ugt3a1 UTSW 15 9280052 splice site probably null
R6937:Ugt3a1 UTSW 15 9292072 missense probably benign 0.00
R7061:Ugt3a1 UTSW 15 9306154 missense probably benign 0.12
R7672:Ugt3a1 UTSW 15 9310693 nonsense probably null
R7840:Ugt3a1 UTSW 15 9311817 missense probably damaging 1.00
R7945:Ugt3a1 UTSW 15 9284175 critical splice donor site probably null
R8105:Ugt3a1 UTSW 15 9306390 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGCCTTTACAAACCACCTC -3'
(R):5'- AGCTGTGATTGCTTGCCTC -3'

Sequencing Primer
(F):5'- CTCTATGATTCTTCTAGGACTTGGAG -3'
(R):5'- TGATTGCTTGCCTCCTAGAG -3'
Posted On2015-03-25