Incidental Mutation 'R3797:Lmf1'
List |< first << previous [record 21 of 43] next >> last >|
ID272816
Institutional Source Beutler Lab
Gene Symbol Lmf1
Ensembl Gene ENSMUSG00000002279
Gene Namelipase maturation factor 1
SynonymsTmem112, 2400010G15Rik
MMRRC Submission 040758-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3797 (G1)
Quality Score222
Status Validated
Chromosome17
Chromosomal Location25579174-25662826 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 25654471 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 317 (V317M)
Ref Sequence ENSEMBL: ENSMUSP00000112340 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063344] [ENSMUST00000116641] [ENSMUST00000137201]
Predicted Effect probably damaging
Transcript: ENSMUST00000063344
AA Change: V317M

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000066682
Gene: ENSMUSG00000002279
AA Change: V317M

DomainStartEndE-ValueType
transmembrane domain 50 72 N/A INTRINSIC
transmembrane domain 97 119 N/A INTRINSIC
transmembrane domain 129 151 N/A INTRINSIC
Pfam:LMF1 169 551 2.3e-142 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000116641
AA Change: V317M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112340
Gene: ENSMUSG00000002279
AA Change: V317M

DomainStartEndE-ValueType
transmembrane domain 50 72 N/A INTRINSIC
transmembrane domain 97 119 N/A INTRINSIC
transmembrane domain 129 151 N/A INTRINSIC
Pfam:LMF1 169 553 1.2e-148 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137201
Predicted Effect probably benign
Transcript: ENSMUST00000141606
SMART Domains Protein: ENSMUSP00000129263
Gene: ENSMUSG00000002279

DomainStartEndE-ValueType
Pfam:LMF1 2 90 9.8e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154842
SMART Domains Protein: ENSMUSP00000119563
Gene: ENSMUSG00000002279

DomainStartEndE-ValueType
transmembrane domain 47 69 N/A INTRINSIC
transmembrane domain 94 116 N/A INTRINSIC
transmembrane domain 126 148 N/A INTRINSIC
Pfam:LMF1 166 298 2.4e-60 PFAM
Meta Mutation Damage Score 0.8099 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene resides in the endoplasmic reticulum, and is involved in the maturation and transport of lipoprotein lipase through the secretory pathway. Mutations in this gene are associated with combined lipase deficiency. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, May 2010]
PHENOTYPE: Mutations in this gene result in neonatal death following progressive cyanosis, combined lipase deficiency, and hypertriglyceridemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf3 T C 5: 30,196,823 I736V possibly damaging Het
Alpk3 C A 7: 81,092,753 P773T probably benign Het
B4galt1 G A 4: 40,807,258 T376I probably benign Het
Basp1 C A 15: 25,364,312 probably benign Het
Capn5 C T 7: 98,125,829 G535R probably null Het
Ccdc170 G A 10: 4,560,920 V660I possibly damaging Het
Cdc73 A T 1: 143,677,723 D215E probably benign Het
Clec14a G A 12: 58,267,909 A309V probably benign Het
Clns1a G A 7: 97,696,835 G36R probably benign Het
Cops7a C T 6: 124,959,832 R252H probably damaging Het
Csmd2 C T 4: 128,517,595 P2469S probably benign Het
Dsp T A 13: 38,177,284 probably null Het
Eif3d A G 15: 77,968,569 F4S probably damaging Het
Ephb1 T C 9: 101,971,267 T611A probably damaging Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Fgfr1 G A 8: 25,572,437 D663N probably damaging Het
Gm5592 G A 7: 41,157,835 probably benign Het
Itgb8 T C 12: 119,163,469 I683M possibly damaging Het
Kcnip3 A G 2: 127,482,014 S32P probably benign Het
Limch1 A G 5: 66,969,079 T8A probably damaging Het
Ltbp1 A G 17: 75,362,630 Q1455R probably damaging Het
Marc2 T C 1: 184,841,308 E131G possibly damaging Het
Olfr620 C T 7: 103,611,447 R302Q probably benign Het
Pak7 T C 2: 136,100,826 I465V probably benign Het
Pcdhgb8 T C 18: 37,762,675 I266T probably benign Het
Pde4d T C 13: 109,632,897 S40P probably benign Het
Phrf1 C T 7: 141,259,918 R243* probably null Het
Polk A T 13: 96,486,982 probably benign Het
Ppl T C 16: 5,104,550 probably benign Het
Rab11fip3 A G 17: 26,068,526 C218R possibly damaging Het
Setd2 T C 9: 110,549,571 V818A probably benign Het
Skida1 C A 2: 18,045,897 E815* probably null Het
Slc35g3 A G 11: 69,760,917 F103L probably benign Het
Svil T A 18: 5,060,534 C802S probably benign Het
Trim7 A G 11: 48,845,670 probably null Het
Ugt3a1 G A 15: 9,310,641 W336* probably null Het
Vmn2r72 T C 7: 85,738,077 S760G probably benign Het
Vps13a T C 19: 16,745,947 probably null Het
Wdfy4 A T 14: 33,140,645 I590N probably damaging Het
Xdh T C 17: 73,907,658 E764G probably damaging Het
Xpnpep1 A T 19: 53,006,342 V285D probably benign Het
Zfp934 T C 13: 62,517,888 K313R probably benign Het
Other mutations in Lmf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03153:Lmf1 APN 17 25585650 missense possibly damaging 0.51
R0117:Lmf1 UTSW 17 25655991 unclassified probably benign
R1757:Lmf1 UTSW 17 25655210 missense probably damaging 1.00
R1906:Lmf1 UTSW 17 25612335 missense probably damaging 0.99
R2389:Lmf1 UTSW 17 25654471 missense probably damaging 1.00
R2446:Lmf1 UTSW 17 25654471 missense probably damaging 1.00
R3798:Lmf1 UTSW 17 25654471 missense probably damaging 1.00
R3855:Lmf1 UTSW 17 25654471 missense probably damaging 1.00
R3953:Lmf1 UTSW 17 25654471 missense probably damaging 1.00
R3955:Lmf1 UTSW 17 25654471 missense probably damaging 1.00
R3956:Lmf1 UTSW 17 25654471 missense probably damaging 1.00
R4290:Lmf1 UTSW 17 25654481 missense probably damaging 1.00
R4291:Lmf1 UTSW 17 25654481 missense probably damaging 1.00
R4293:Lmf1 UTSW 17 25654481 missense probably damaging 1.00
R4636:Lmf1 UTSW 17 25654471 missense probably damaging 1.00
R4698:Lmf1 UTSW 17 25579350 missense probably damaging 0.98
R4791:Lmf1 UTSW 17 25654471 missense probably damaging 1.00
R4792:Lmf1 UTSW 17 25654471 missense probably damaging 1.00
R4968:Lmf1 UTSW 17 25585618 missense probably damaging 1.00
R4997:Lmf1 UTSW 17 25588676 nonsense probably null
R5047:Lmf1 UTSW 17 25631838 intron probably benign
R5152:Lmf1 UTSW 17 25655519 missense probably damaging 0.99
R5419:Lmf1 UTSW 17 25662636 missense possibly damaging 0.94
R6162:Lmf1 UTSW 17 25612394 missense probably benign 0.00
R6693:Lmf1 UTSW 17 25645278 missense probably benign 0.00
R7583:Lmf1 UTSW 17 25655449 missense
R7642:Lmf1 UTSW 17 25654471 missense probably damaging 1.00
R7667:Lmf1 UTSW 17 25654608 critical splice donor site probably null
R7671:Lmf1 UTSW 17 25579349 missense possibly damaging 0.75
R7818:Lmf1 UTSW 17 25662591 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- GACTTGGGACCAGAACTGAG -3'
(R):5'- TTCATGAGGCTTAGGCAGGAGG -3'

Sequencing Primer
(F):5'- CTTGGGACCAGAACTGAGAGAATG -3'
(R):5'- GCTTAGGCAGGAGGGTCATG -3'
Posted On2015-03-25