Incidental Mutation 'R3797:Vps13a'
ID272823
Institutional Source Beutler Lab
Gene Symbol Vps13a
Ensembl Gene ENSMUSG00000046230
Gene Namevacuolar protein sorting 13A
Synonyms4930516E05Rik, 4930543C13Rik, D330038K10Rik
MMRRC Submission 040758-MU
Accession Numbers

Ncbi RefSeq: NM_173028.4; MGI:2444304

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3797 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location16615366-16780933 bp(-) (GRCm38)
Type of Mutationsplice site (4 bp from exon)
DNA Base Change (assembly) T to C at 16745947 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000068716 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068156] [ENSMUST00000224149]
Predicted Effect probably null
Transcript: ENSMUST00000068156
SMART Domains Protein: ENSMUSP00000068716
Gene: ENSMUSG00000046230

DomainStartEndE-ValueType
Pfam:Chorein_N 3 117 5.4e-38 PFAM
Pfam:VPS13 139 371 3.7e-64 PFAM
low complexity region 553 563 N/A INTRINSIC
Pfam:VPS13_mid_rpt 567 791 1.4e-69 PFAM
Pfam:VPS13_mid_rpt 1138 1329 2e-10 PFAM
low complexity region 1367 1377 N/A INTRINSIC
Blast:INB 1575 1855 1e-149 BLAST
Pfam:SHR-BD 2200 2449 1.3e-35 PFAM
low complexity region 2510 2521 N/A INTRINSIC
low complexity region 2632 2648 N/A INTRINSIC
low complexity region 2719 2731 N/A INTRINSIC
Pfam:VPS13_C 2755 2935 8.9e-66 PFAM
Pfam:ATG_C 2938 3029 1.6e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223846
Predicted Effect probably benign
Transcript: ENSMUST00000224149
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224428
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225079
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (39/39)
MGI Phenotype Strain: 3531502
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene may control steps in the cycling of proteins through the trans-Golgi network to endosomes, lysosomes and the plasma membrane. Mutations in this gene cause the autosomal recessive disorder, chorea-acanthocytosis. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Aging mice homozygous for a knock-out allele display motor dysfunction and abnormal social interaction, hematologic anomalies including acanthocytosis, selective atrophy of the striatum with significant apoptosis and gliosis, and reduced homovanillic acid levels in midbrain. [provided by MGI curators]
Allele List at MGI

All alleles(8) : Targeted(3) Gene trapped(5)

Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf3 T C 5: 30,196,823 I736V possibly damaging Het
Alpk3 C A 7: 81,092,753 P773T probably benign Het
B4galt1 G A 4: 40,807,258 T376I probably benign Het
Basp1 C A 15: 25,364,312 probably benign Het
Capn5 C T 7: 98,125,829 G535R probably null Het
Ccdc170 G A 10: 4,560,920 V660I possibly damaging Het
Cdc73 A T 1: 143,677,723 D215E probably benign Het
Clec14a G A 12: 58,267,909 A309V probably benign Het
Clns1a G A 7: 97,696,835 G36R probably benign Het
Cops7a C T 6: 124,959,832 R252H probably damaging Het
Csmd2 C T 4: 128,517,595 P2469S probably benign Het
Dsp T A 13: 38,177,284 probably null Het
Eif3d A G 15: 77,968,569 F4S probably damaging Het
Ephb1 T C 9: 101,971,267 T611A probably damaging Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Fgfr1 G A 8: 25,572,437 D663N probably damaging Het
Gm5592 G A 7: 41,157,835 probably benign Het
Itgb8 T C 12: 119,163,469 I683M possibly damaging Het
Kcnip3 A G 2: 127,482,014 S32P probably benign Het
Limch1 A G 5: 66,969,079 T8A probably damaging Het
Lmf1 G A 17: 25,654,471 V317M probably damaging Het
Ltbp1 A G 17: 75,362,630 Q1455R probably damaging Het
Marc2 T C 1: 184,841,308 E131G possibly damaging Het
Olfr620 C T 7: 103,611,447 R302Q probably benign Het
Pak7 T C 2: 136,100,826 I465V probably benign Het
Pcdhgb8 T C 18: 37,762,675 I266T probably benign Het
Pde4d T C 13: 109,632,897 S40P probably benign Het
Phrf1 C T 7: 141,259,918 R243* probably null Het
Polk A T 13: 96,486,982 probably benign Het
Ppl T C 16: 5,104,550 probably benign Het
Rab11fip3 A G 17: 26,068,526 C218R possibly damaging Het
Setd2 T C 9: 110,549,571 V818A probably benign Het
Skida1 C A 2: 18,045,897 E815* probably null Het
Slc35g3 A G 11: 69,760,917 F103L probably benign Het
Svil T A 18: 5,060,534 C802S probably benign Het
Trim7 A G 11: 48,845,670 probably null Het
Ugt3a1 G A 15: 9,310,641 W336* probably null Het
Vmn2r72 T C 7: 85,738,077 S760G probably benign Het
Wdfy4 A T 14: 33,140,645 I590N probably damaging Het
Xdh T C 17: 73,907,658 E764G probably damaging Het
Xpnpep1 A T 19: 53,006,342 V285D probably benign Het
Zfp934 T C 13: 62,517,888 K313R probably benign Het
Other mutations in Vps13a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Vps13a APN 19 16752175 missense probably damaging 0.98
IGL00537:Vps13a APN 19 16680045 missense probably benign 0.03
IGL00562:Vps13a APN 19 16734714 critical splice donor site probably null
IGL00563:Vps13a APN 19 16734714 critical splice donor site probably null
IGL00579:Vps13a APN 19 16707362 missense probably benign 0.29
IGL00662:Vps13a APN 19 16704540 missense probably damaging 0.96
IGL00667:Vps13a APN 19 16759676 missense probably damaging 1.00
IGL01102:Vps13a APN 19 16651417 critical splice donor site probably null
IGL01139:Vps13a APN 19 16640625 missense probably damaging 0.99
IGL01142:Vps13a APN 19 16687115 missense possibly damaging 0.86
IGL01361:Vps13a APN 19 16743007 missense probably damaging 1.00
IGL01386:Vps13a APN 19 16701152 missense possibly damaging 0.87
IGL01593:Vps13a APN 19 16762181 missense probably damaging 0.98
IGL01700:Vps13a APN 19 16744857 nonsense probably null
IGL01767:Vps13a APN 19 16663894 missense probably damaging 1.00
IGL01782:Vps13a APN 19 16754337 missense probably damaging 0.98
IGL01808:Vps13a APN 19 16710286 missense probably damaging 1.00
IGL01812:Vps13a APN 19 16715060 missense probably benign
IGL01829:Vps13a APN 19 16619443 missense probably benign 0.01
IGL01893:Vps13a APN 19 16663775 missense probably damaging 1.00
IGL02222:Vps13a APN 19 16682175 missense probably benign 0.06
IGL02295:Vps13a APN 19 16715042 splice site probably benign
IGL02465:Vps13a APN 19 16710941 missense probably benign 0.11
IGL02492:Vps13a APN 19 16647637 missense probably damaging 1.00
IGL02581:Vps13a APN 19 16655322 missense probably benign 0.41
IGL02633:Vps13a APN 19 16720408 missense possibly damaging 0.82
IGL02641:Vps13a APN 19 16698821 missense probably benign 0.01
IGL02659:Vps13a APN 19 16652699 missense probably damaging 1.00
IGL02827:Vps13a APN 19 16641634 missense possibly damaging 0.91
IGL02943:Vps13a APN 19 16663886 missense probably damaging 1.00
IGL03057:Vps13a APN 19 16668694 missense probably damaging 1.00
IGL03077:Vps13a APN 19 16710882 missense probably benign
IGL03184:Vps13a APN 19 16654370 missense probably benign 0.00
eggs UTSW 19 16701165 missense probably damaging 1.00
excambio UTSW 19 16745947 splice site probably null
Ham UTSW 19 16677969 missense probably benign 0.08
interchange UTSW 19 16668690 missense probably damaging 1.00
PIT4377001:Vps13a UTSW 19 16740901 missense probably damaging 1.00
R0045:Vps13a UTSW 19 16640810 nonsense probably null
R0045:Vps13a UTSW 19 16640810 nonsense probably null
R0048:Vps13a UTSW 19 16676140 missense probably damaging 1.00
R0062:Vps13a UTSW 19 16668690 missense probably damaging 1.00
R0062:Vps13a UTSW 19 16668690 missense probably damaging 1.00
R0107:Vps13a UTSW 19 16691824 missense probably benign 0.03
R0135:Vps13a UTSW 19 16780765 missense probably damaging 1.00
R0138:Vps13a UTSW 19 16660499 missense possibly damaging 0.95
R0346:Vps13a UTSW 19 16677969 missense probably benign 0.08
R0359:Vps13a UTSW 19 16641577 missense probably damaging 0.99
R0530:Vps13a UTSW 19 16655206 splice site probably benign
R0541:Vps13a UTSW 19 16704577 missense probably benign 0.00
R0614:Vps13a UTSW 19 16652694 missense probably damaging 1.00
R0685:Vps13a UTSW 19 16780741 missense probably damaging 1.00
R0801:Vps13a UTSW 19 16686656 splice site probably benign
R0835:Vps13a UTSW 19 16734882 intron probably null
R0848:Vps13a UTSW 19 16698897 missense probably damaging 1.00
R1114:Vps13a UTSW 19 16750151 missense probably benign 0.41
R1205:Vps13a UTSW 19 16640541 missense probably damaging 1.00
R1365:Vps13a UTSW 19 16619446 missense probably damaging 1.00
R1445:Vps13a UTSW 19 16701238 nonsense probably null
R1451:Vps13a UTSW 19 16710864 missense probably benign 0.01
R1479:Vps13a UTSW 19 16750114 splice site probably benign
R1533:Vps13a UTSW 19 16701130 nonsense probably null
R1600:Vps13a UTSW 19 16666272 missense probably benign 0.01
R1870:Vps13a UTSW 19 16759952 missense probably damaging 1.00
R1871:Vps13a UTSW 19 16664664 missense probably benign 0.01
R1959:Vps13a UTSW 19 16677938 missense possibly damaging 0.49
R1960:Vps13a UTSW 19 16725631 missense probably damaging 1.00
R1993:Vps13a UTSW 19 16722458 missense probably benign 0.07
R2257:Vps13a UTSW 19 16682174 missense possibly damaging 0.85
R2276:Vps13a UTSW 19 16710426 missense possibly damaging 0.47
R2326:Vps13a UTSW 19 16743057 missense possibly damaging 0.71
R2338:Vps13a UTSW 19 16720453 missense probably damaging 1.00
R2359:Vps13a UTSW 19 16652679 splice site probably benign
R2421:Vps13a UTSW 19 16759671 missense probably benign
R2847:Vps13a UTSW 19 16703599 missense probably damaging 0.98
R3081:Vps13a UTSW 19 16664737 missense probably benign 0.02
R3522:Vps13a UTSW 19 16766493 splice site probably benign
R3613:Vps13a UTSW 19 16685402 missense probably damaging 1.00
R3874:Vps13a UTSW 19 16744953 missense probably benign 0.01
R4032:Vps13a UTSW 19 16616899 missense probably damaging 1.00
R4111:Vps13a UTSW 19 16640628 missense probably damaging 1.00
R4383:Vps13a UTSW 19 16701165 missense probably damaging 1.00
R4504:Vps13a UTSW 19 16695502 missense possibly damaging 0.93
R4578:Vps13a UTSW 19 16682110 missense probably damaging 0.98
R4587:Vps13a UTSW 19 16640039 missense probably damaging 1.00
R4588:Vps13a UTSW 19 16640039 missense probably damaging 1.00
R4605:Vps13a UTSW 19 16640039 missense probably damaging 1.00
R4714:Vps13a UTSW 19 16749856 missense probably benign 0.01
R4756:Vps13a UTSW 19 16655216 missense probably benign 0.01
R4831:Vps13a UTSW 19 16677992 missense probably benign 0.04
R5068:Vps13a UTSW 19 16746058 missense probably benign 0.01
R5070:Vps13a UTSW 19 16654484 missense probably benign
R5082:Vps13a UTSW 19 16744893 missense probably damaging 1.00
R5182:Vps13a UTSW 19 16695499 missense possibly damaging 0.81
R5189:Vps13a UTSW 19 16685315 missense probably damaging 1.00
R5283:Vps13a UTSW 19 16677970 missense probably damaging 0.96
R5294:Vps13a UTSW 19 16641667 missense probably damaging 1.00
R5304:Vps13a UTSW 19 16710387 missense possibly damaging 0.78
R5554:Vps13a UTSW 19 16722411 missense probably damaging 1.00
R5592:Vps13a UTSW 19 16725571 missense probably damaging 1.00
R5611:Vps13a UTSW 19 16725572 missense probably damaging 1.00
R5665:Vps13a UTSW 19 16668690 missense probably damaging 1.00
R5671:Vps13a UTSW 19 16715100 missense probably benign 0.03
R5684:Vps13a UTSW 19 16699045 missense probably benign 0.00
R5767:Vps13a UTSW 19 16664564 missense probably damaging 1.00
R5810:Vps13a UTSW 19 16666324 missense probably benign 0.00
R5866:Vps13a UTSW 19 16680023 missense probably benign 0.04
R5886:Vps13a UTSW 19 16664562 missense probably benign 0.01
R5933:Vps13a UTSW 19 16660530 missense probably benign 0.34
R5965:Vps13a UTSW 19 16619028 intron probably null
R6259:Vps13a UTSW 19 16687170 nonsense probably null
R6346:Vps13a UTSW 19 16682214 missense possibly damaging 0.94
R6459:Vps13a UTSW 19 16664018 missense possibly damaging 0.56
R6485:Vps13a UTSW 19 16680050 missense probably damaging 0.99
R6520:Vps13a UTSW 19 16725579 missense probably damaging 1.00
R6644:Vps13a UTSW 19 16744919 missense possibly damaging 0.90
R6932:Vps13a UTSW 19 16678075 missense probably benign 0.01
R6934:Vps13a UTSW 19 16676194 missense probably damaging 1.00
R6951:Vps13a UTSW 19 16723740 missense probably benign 0.00
R7027:Vps13a UTSW 19 16664664 missense probably benign 0.01
R7126:Vps13a UTSW 19 16710879 missense probably benign
R7206:Vps13a UTSW 19 16754298 missense probably damaging 1.00
R7248:Vps13a UTSW 19 16678042 missense probably benign 0.25
R7252:Vps13a UTSW 19 16661064 missense probably benign 0.00
R7255:Vps13a UTSW 19 16654339 critical splice donor site probably null
R7382:Vps13a UTSW 19 16619485 missense probably damaging 1.00
R7422:Vps13a UTSW 19 16750173 missense probably damaging 1.00
R7425:Vps13a UTSW 19 16723702 missense probably benign 0.13
R7523:Vps13a UTSW 19 16703789 missense probably benign
R7586:Vps13a UTSW 19 16647598 missense probably benign 0.08
R7587:Vps13a UTSW 19 16703789 missense probably benign 0.00
R7593:Vps13a UTSW 19 16725663 missense probably damaging 1.00
R7637:Vps13a UTSW 19 16750149 missense probably benign 0.02
R7763:Vps13a UTSW 19 16746000 missense possibly damaging 0.95
R7813:Vps13a UTSW 19 16651456 missense possibly damaging 0.81
R7815:Vps13a UTSW 19 16725572 missense probably damaging 1.00
R7861:Vps13a UTSW 19 16655304 missense probably damaging 1.00
R7909:Vps13a UTSW 19 16720430 nonsense probably null
R8108:Vps13a UTSW 19 16640787 missense probably damaging 1.00
R8123:Vps13a UTSW 19 16647702 missense probably benign 0.01
R8134:Vps13a UTSW 19 16654354 missense possibly damaging 0.71
R8168:Vps13a UTSW 19 16749548 missense probably benign 0.09
R8272:Vps13a UTSW 19 16749845 critical splice donor site probably null
R8293:Vps13a UTSW 19 16668605 missense possibly damaging 0.81
R8303:Vps13a UTSW 19 16616906 missense probably benign 0.00
X0061:Vps13a UTSW 19 16645868 missense probably benign 0.40
X0066:Vps13a UTSW 19 16742553 missense probably benign 0.33
Z1177:Vps13a UTSW 19 16699113 critical splice acceptor site probably null
Z31818:Vps13a UTSW 19 16780754 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TGACTCGAGAAGCTCCATGAG -3'
(R):5'- GCTGTGGTAGAGGTTCAAAGATC -3'

Sequencing Primer
(F):5'- GCTCCATGAGGCTGAAATACTAG -3'
(R):5'- AGAGGTTCAAAGATCTTTATTGGTCG -3'
Posted On2015-03-25