Incidental Mutation 'R3798:Lancl1'
ID 272825
Institutional Source Beutler Lab
Gene Symbol Lancl1
Ensembl Gene ENSMUSG00000026000
Gene Name LanC (bacterial lantibiotic synthetase component C)-like 1
Synonyms p40, Gpr69a, LanC-like protein 1
Accession Numbers
Essential gene? Probably non essential (E-score: 0.090) question?
Stock # R3798 (G1)
Quality Score 219
Status Not validated
Chromosome 1
Chromosomal Location 67039676-67078031 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 67073303 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 60 (T60I)
Ref Sequence ENSEMBL: ENSMUSP00000122752 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027149] [ENSMUST00000113979] [ENSMUST00000119559] [ENSMUST00000149996]
AlphaFold O89112
Predicted Effect probably damaging
Transcript: ENSMUST00000027149
AA Change: T60I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000027149
Gene: ENSMUSG00000026000
AA Change: T60I

DomainStartEndE-ValueType
LANC_like 55 399 7.17e-144 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113979
AA Change: T60I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109612
Gene: ENSMUSG00000026000
AA Change: T60I

DomainStartEndE-ValueType
LANC_like 55 399 7.17e-144 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000119559
AA Change: T60I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113080
Gene: ENSMUSG00000026000
AA Change: T60I

DomainStartEndE-ValueType
LANC_like 55 399 7.17e-144 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000149996
AA Change: T60I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122752
Gene: ENSMUSG00000026000
AA Change: T60I

DomainStartEndE-ValueType
Pfam:LANC_like 55 173 2.3e-29 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a loosely associated peripheral membrane protein related to the LanC family of bacterial membrane-associated proteins involved in the biosynthesis of antimicrobial peptides. This protein may play a role as a peptide-modifying enzyme component in eukaryotic cells. Previously considered a member of the G-protein-coupled receptor superfamily, this protein is now in the LanC family. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Nov 2008]
PHENOTYPE: Mice homozygous for a null mutation display postnatal neurodegeneration with increased oxidative stress and mitochondrial impairment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadsb T A 7: 131,033,694 (GRCm39) V237E probably damaging Het
Adgrf3 T C 5: 30,401,821 (GRCm39) I736V possibly damaging Het
Alpk3 C A 7: 80,742,501 (GRCm39) P773T probably benign Het
Basp1 C A 15: 25,364,398 (GRCm39) probably benign Het
Bbs9 T C 9: 22,550,065 (GRCm39) S21P probably damaging Het
Btbd16 A G 7: 130,378,870 (GRCm39) N5D probably benign Het
Csmd2 C T 4: 128,411,388 (GRCm39) P2469S probably benign Het
Cyld T C 8: 89,461,558 (GRCm39) L662P probably damaging Het
Eif2ak4 C T 2: 118,304,564 (GRCm39) R1530C probably damaging Het
Fam43b G C 4: 138,122,409 (GRCm39) R304G probably benign Het
Ip6k3 T C 17: 27,364,080 (GRCm39) I323V probably benign Het
Itpr1 T C 6: 108,358,231 (GRCm39) L599P probably damaging Het
Lmf1 G A 17: 25,873,445 (GRCm39) V317M probably damaging Het
Lrrc8d T A 5: 105,960,355 (GRCm39) I255N probably benign Het
Ndst1 A G 18: 60,846,238 (GRCm39) F24L possibly damaging Het
Notch1 A T 2: 26,368,630 (GRCm39) V553E probably benign Het
Nsd3 T A 8: 26,188,873 (GRCm39) W69R probably damaging Het
Or2g25 T A 17: 37,970,997 (GRCm39) I76F probably damaging Het
Pcm1 T C 8: 41,711,051 (GRCm39) I107T possibly damaging Het
Pcnx3 G A 19: 5,728,696 (GRCm39) Q422* probably null Het
Phrf1 C T 7: 140,839,831 (GRCm39) R243* probably null Het
Ptbp3 T C 4: 59,546,166 (GRCm39) I9V probably benign Het
Sacs T C 14: 61,443,570 (GRCm39) V1872A possibly damaging Het
Slc35g3 A G 11: 69,651,743 (GRCm39) F103L probably benign Het
Slx4ip T A 2: 136,909,543 (GRCm39) D109E probably benign Het
Tas2r118 T C 6: 23,969,822 (GRCm39) K80E possibly damaging Het
Ttn T C 2: 76,725,087 (GRCm39) probably benign Het
Vmn2r72 T C 7: 85,387,285 (GRCm39) S760G probably benign Het
Vmn2r79 A G 7: 86,651,402 (GRCm39) Y267C possibly damaging Het
Wdr90 T C 17: 26,069,472 (GRCm39) S1194G probably benign Het
Xdh T C 17: 74,214,653 (GRCm39) E764G probably damaging Het
Other mutations in Lancl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00852:Lancl1 APN 1 67,043,996 (GRCm39) missense probably damaging 1.00
IGL01727:Lancl1 APN 1 67,060,101 (GRCm39) missense probably damaging 1.00
IGL01800:Lancl1 APN 1 67,060,029 (GRCm39) missense probably benign 0.08
IGL03036:Lancl1 APN 1 67,046,074 (GRCm39) missense probably damaging 1.00
IGL03329:Lancl1 APN 1 67,060,209 (GRCm39) missense probably damaging 1.00
R0535:Lancl1 UTSW 1 67,049,065 (GRCm39) unclassified probably benign
R0731:Lancl1 UTSW 1 67,049,069 (GRCm39) critical splice donor site probably null
R4405:Lancl1 UTSW 1 67,060,015 (GRCm39) critical splice donor site probably null
R4933:Lancl1 UTSW 1 67,060,193 (GRCm39) missense probably benign 0.08
R4980:Lancl1 UTSW 1 67,043,968 (GRCm39) missense probably benign 0.17
R5193:Lancl1 UTSW 1 67,060,173 (GRCm39) missense probably benign 0.02
R6643:Lancl1 UTSW 1 67,043,542 (GRCm39) missense probably benign 0.07
R7235:Lancl1 UTSW 1 67,077,694 (GRCm39) missense probably benign 0.00
R7250:Lancl1 UTSW 1 67,048,458 (GRCm39) missense possibly damaging 0.54
R8854:Lancl1 UTSW 1 67,073,358 (GRCm39) missense possibly damaging 0.86
R9105:Lancl1 UTSW 1 67,043,962 (GRCm39) missense possibly damaging 0.74
R9323:Lancl1 UTSW 1 67,077,794 (GRCm39) intron probably benign
R9487:Lancl1 UTSW 1 67,073,381 (GRCm39) missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- TTCTCCTCACAGTAAACGCC -3'
(R):5'- GTTCCATATGTGGTTTCTGAAAAGC -3'

Sequencing Primer
(F):5'- ACAGTTCTGGAAAGGTCC -3'
(R):5'- TGTGGTTTCTGAAAAGCTACTTTAAG -3'
Posted On 2015-03-25