Incidental Mutation 'R3798:Ptbp3'
ID272834
Institutional Source Beutler Lab
Gene Symbol Ptbp3
Ensembl Gene ENSMUSG00000028382
Gene Namepolypyrimidine tract binding protein 3
SynonymsRod1, 5830471K22Rik
Accession Numbers

Genbank: NM_144904; MGI: 1923334; Ensembl: ENSMUST00000030076

Is this an essential gene? Possibly non essential (E-score: 0.349) question?
Stock #R3798 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location59471868-59549364 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 59546166 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 9 (I9V)
Ref Sequence ENSEMBL: ENSMUSP00000133884 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030076] [ENSMUST00000102883] [ENSMUST00000134879] [ENSMUST00000140925] [ENSMUST00000148331] [ENSMUST00000172768] [ENSMUST00000173699] [ENSMUST00000173884] [ENSMUST00000174586] [ENSMUST00000174748]
Predicted Effect probably benign
Transcript: ENSMUST00000030076
SMART Domains Protein: ENSMUSP00000030076
Gene: ENSMUSG00000028382

DomainStartEndE-ValueType
RRM 31 100 2.24e-3 SMART
low complexity region 115 130 N/A INTRINSIC
RRM 154 223 2.51e-6 SMART
low complexity region 277 293 N/A INTRINSIC
RRM 330 399 2.13e-9 SMART
RRM 447 517 1.29e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000052502
Predicted Effect probably benign
Transcript: ENSMUST00000102883
AA Change: I9V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000099947
Gene: ENSMUSG00000028382
AA Change: I9V

DomainStartEndE-ValueType
RRM 59 128 2.24e-3 SMART
low complexity region 143 158 N/A INTRINSIC
RRM 182 251 2.51e-6 SMART
low complexity region 305 321 N/A INTRINSIC
RRM 358 427 2.13e-9 SMART
RRM 475 545 1.29e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000134879
Predicted Effect probably benign
Transcript: ENSMUST00000140925
AA Change: I11V

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000122138
Gene: ENSMUSG00000028382
AA Change: I11V

DomainStartEndE-ValueType
SCOP:d1qm9a2 53 99 2e-4 SMART
PDB:2CQ1|A 54 101 8e-19 PDB
Blast:RRM 64 100 4e-19 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000148331
SMART Domains Protein: ENSMUSP00000122840
Gene: ENSMUSG00000028382

DomainStartEndE-ValueType
RRM 28 97 2.24e-3 SMART
low complexity region 112 127 N/A INTRINSIC
RRM 151 220 2.51e-6 SMART
low complexity region 274 290 N/A INTRINSIC
RRM 327 396 2.13e-9 SMART
RRM 444 514 1.29e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172768
SMART Domains Protein: ENSMUSP00000134102
Gene: ENSMUSG00000028382

DomainStartEndE-ValueType
RRM 28 97 2.24e-3 SMART
low complexity region 112 127 N/A INTRINSIC
RRM 151 220 2.51e-6 SMART
low complexity region 274 290 N/A INTRINSIC
RRM 327 396 2.13e-9 SMART
RRM 444 514 1.29e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173699
SMART Domains Protein: ENSMUSP00000134290
Gene: ENSMUSG00000028382

DomainStartEndE-ValueType
PDB:2CQ1|A 2 44 7e-18 PDB
low complexity region 49 64 N/A INTRINSIC
RRM 88 157 2.51e-6 SMART
low complexity region 211 227 N/A INTRINSIC
RRM 264 333 2.13e-9 SMART
RRM 381 451 1.29e-8 SMART
Predicted Effect unknown
Transcript: ENSMUST00000173884
AA Change: I9V
SMART Domains Protein: ENSMUSP00000133996
Gene: ENSMUSG00000028382
AA Change: I9V

DomainStartEndE-ValueType
low complexity region 16 28 N/A INTRINSIC
RRM 52 121 2.51e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174586
AA Change: I9V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000133612
Gene: ENSMUSG00000028382
AA Change: I9V

DomainStartEndE-ValueType
RRM 62 131 2.24e-3 SMART
low complexity region 146 161 N/A INTRINSIC
RRM 185 254 2.51e-6 SMART
low complexity region 308 324 N/A INTRINSIC
RRM 361 430 2.13e-9 SMART
RRM 478 548 1.29e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174748
AA Change: I9V

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene binds RNA and is a regulator of cell differentiation. The encoded protein preferentially binds to poly(G) and poly(U) sequences in vitro. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Allele List at MGI

All alleles(6) : Gene trapped(6)

Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadsb T A 7: 131,431,965 V237E probably damaging Het
Adgrf3 T C 5: 30,196,823 I736V possibly damaging Het
Alpk3 C A 7: 81,092,753 P773T probably benign Het
Basp1 C A 15: 25,364,312 probably benign Het
Bbs9 T C 9: 22,638,769 S21P probably damaging Het
Btbd16 A G 7: 130,777,140 N5D probably benign Het
Csmd2 C T 4: 128,517,595 P2469S probably benign Het
Cyld T C 8: 88,734,930 L662P probably damaging Het
Eif2ak4 C T 2: 118,474,083 R1530C probably damaging Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Ip6k3 T C 17: 27,145,106 I323V probably benign Het
Itpr1 T C 6: 108,381,270 L599P probably damaging Het
Lancl1 G A 1: 67,034,144 T60I probably damaging Het
Lmf1 G A 17: 25,654,471 V317M probably damaging Het
Lrrc8d T A 5: 105,812,489 I255N probably benign Het
Ndst1 A G 18: 60,713,166 F24L possibly damaging Het
Notch1 A T 2: 26,478,618 V553E probably benign Het
Nsd3 T A 8: 25,698,845 W69R probably damaging Het
Olfr117 T A 17: 37,660,106 I76F probably damaging Het
Pcm1 T C 8: 41,258,014 I107T possibly damaging Het
Pcnx3 G A 19: 5,678,668 Q422* probably null Het
Phrf1 C T 7: 141,259,918 R243* probably null Het
Sacs T C 14: 61,206,121 V1872A possibly damaging Het
Slc35g3 A G 11: 69,760,917 F103L probably benign Het
Slx4ip T A 2: 137,067,623 D109E probably benign Het
Tas2r118 T C 6: 23,969,823 K80E possibly damaging Het
Ttn T C 2: 76,894,743 probably benign Het
Vmn2r72 T C 7: 85,738,077 S760G probably benign Het
Vmn2r79 A G 7: 87,002,194 Y267C possibly damaging Het
Wdr90 T C 17: 25,850,498 S1194G probably benign Het
Xdh T C 17: 73,907,658 E764G probably damaging Het
Other mutations in Ptbp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00932:Ptbp3 APN 4 59477228 missense probably benign 0.29
IGL03035:Ptbp3 APN 4 59477218 missense probably benign 0.00
IGL03118:Ptbp3 APN 4 59501470 missense probably benign 0.03
IGL03257:Ptbp3 APN 4 59493370 splice site probably benign
IGL03279:Ptbp3 APN 4 59476937 missense possibly damaging 0.68
R0557:Ptbp3 UTSW 4 59517684 nonsense probably null
R1741:Ptbp3 UTSW 4 59482624 missense probably damaging 0.98
R1914:Ptbp3 UTSW 4 59517635 missense probably damaging 1.00
R1915:Ptbp3 UTSW 4 59517635 missense probably damaging 1.00
R2679:Ptbp3 UTSW 4 59494615 splice site probably benign
R4793:Ptbp3 UTSW 4 59514297 missense possibly damaging 0.71
R4869:Ptbp3 UTSW 4 59524443 missense possibly damaging 0.79
R5573:Ptbp3 UTSW 4 59485626 missense probably damaging 1.00
R5986:Ptbp3 UTSW 4 59493311 missense probably benign 0.37
R6350:Ptbp3 UTSW 4 59482624 missense probably damaging 0.98
R6659:Ptbp3 UTSW 4 59517640 missense probably damaging 1.00
R7283:Ptbp3 UTSW 4 59514384 missense probably benign 0.00
R7523:Ptbp3 UTSW 4 59546159 missense probably benign
R7566:Ptbp3 UTSW 4 59514280 missense probably benign 0.03
YA93:Ptbp3 UTSW 4 59524413 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- GCCACAAGCCTACTTATTTTGG -3'
(R):5'- AAGCACAACTGTTCTTTCCTACAC -3'

Sequencing Primer
(F):5'- CTGGTGGGGAAATGTCAA -3'
(R):5'- ACTGTTCTTTCCTACACACTAGAGAG -3'
Posted On2015-03-25